New variochelins from soil-isolated Variovorax sp. H002

• Jabal Rahmat Haedar,
• Aya Yoshimura and
• Toshiyuki Wakimoto

Beilstein J. Org. Chem. 2024, 20, 692–700, doi:10.3762/bjoc.20.63

• amplified by PCR, using Variovorax sp. H002 genomic DNA as the template. The chloramphenicol-resistance gene (cmR) and a linearized recipient plasmid pRED were amplified by PCR, using pRED as the template. The primer sets used to amplify the above-mentioned four fragments are listed in Table S2 (Supporting

• were collected and spread onto 2xR2A agar plates with chloramphenicol (30 µg/mL) and kanamycin (50 µg/mL). The plates were incubated at 30 °C until colonies formed. The disruption of varG was confirmed by PCR amplification. Effect of ferric ion (Fe3+) concentration on production of variochelins An

A new analog of dihydroxybenzoic acid from Saccharopolyspora sp. KR21-0001

• Rattiya Janthanom,
• Yuta Kikuchi,
• Hiroki Kanto,
• Tomoyasu Hirose,
• Arisu Tahara,
• Takahiro Ishii,
• Arinthip Thamchaipenet and
• Yuki Inahashi

Beilstein J. Org. Chem. 2024, 20, 497–503, doi:10.3762/bjoc.20.44

• Island, Ou, Kumejima, Shimajiri District, Okinawa, Japan. Genomic DNA was prepared, and the 16S rRNA gene was amplified by PCR using the method of Inahashi and co-workers [23]. The sequencing analysis was performed by Eurofins Genomics. Similarity of 16S rRNA gene sequence was computed by using

Elucidating the glycan-binding specificity and structure of Cucumis melo agglutinin, a new R-type lectin

• Jon Lundstrøm,
• Emilie Gillon,
• Valérie Chazalet,
• Nicole Kerekes,
• Antonio Di Maio,
• Ten Feizi,
• Yan Liu,
• Annabelle Varrot and
• Daniel Bojar

Beilstein J. Org. Chem. 2024, 20, 306–320, doi:10.3762/bjoc.20.31

• . This plasmid was obtained by PCR using pET-40b(+) (Novagen, Merck, #70091) as template and the following primers: forward (gcccagatctgggtaccGAAAACCTGTATTTTCAGGGCGccatggcgatatcgg) and reverse (GGTACCCAGATCTGGGCTGTCCATGTGCTGGC) with complementary sequence underlined. PCR was performed using PrimeSTAR DNA

• supplier instructions (New England Biolabs, #T1020S) and ligation using the DNA ligation kit, Mighty Mix (Ozyme, Takara, #TAK6023Z), at room temperature to form the pET40b-TEV-CMA11 plasmid. The N-terminal domain of CMA1 (6–132 in mature protein) was amplified by PCR using the following primers: forward

• (ACGCCATGGTGAGCCGTTCTACGC) and reverse (ATATCTCGAGTTAATCTG CCGTACCCCAGGATTGTGTAGG) and pET40b-TEV-CMA1 plasmid as template. Similarly, the C-terminal domain of CMA1 (136–264 in mature protein) was amplified by PCR using the subsequent primers: forward (ATTCCATGGGTCCGATTGTGGTTGCCATTGTTGG) and reverse

Identification of the p-coumaric acid biosynthetic gene cluster in Kutzneria albida: insights into the diazotization-dependent deamination pathway

• Seiji Kawai,
• Akito Yamada,
• Yohei Katsuyama and
• Yasuo Ohnishi

Beilstein J. Org. Chem. 2024, 20, 1–11, doi:10.3762/bjoc.20.1

• ) and 3-aminoavenalumic acid (7) were synthesized in our previous study [13]. Construction of heterologous expression vectors First, pHKO4-cmaI-D was constructed by cloning the cmaI-H-A1-A2-A3-A4-A5-A6-B-A7-E-D operon (which was amplified by PCR using K. albida genomic DNA as the template) into the NdeI

• and HindIII sites of pHKO4 using In-Fusion (TaKaRa Bio Inc.) [20]. pTYM3a-cmaG was constructed by cloning cmaG (which was amplified by PCR using K. albida genomic DNA as the template) into the NdeI and XbaI sites of pTYM3a using In-Fusion (TaKaRa Bio Inc.). The primers used for plasmid construction

• NMR system (JEOL, Tokyo, Japan) (Table S1 and Figures S9–S13 in Supporting Information File 1). Production and purification of recombinant proteins pColdI-cmaA1, pColdI-cmaA3, and pColdI-cmaA6 were constructed by cloning each gene (which was amplified by PCR using pHKO4-cmaI-D as a template) into the

Long oligodeoxynucleotides: chemical synthesis, isolation via catching-by-polymerization, verification via sequencing, and gene expression demonstration

• Yipeng Yin,
• Reed Arneson,
• Alexander Apostle,
• Adikari M. D. N. Eriyagama,
• Komal Chillar,
• Emma Burke,
• Martina Jahfetson,
• Yinan Yuan and
• Shiyue Fang

Beilstein J. Org. Chem. 2023, 19, 1957–1965, doi:10.3762/bjoc.19.146

• and Environmental Science, Michigan Technological University, 1400 Townsend Drive, Houghton, MI 49931, USA 10.3762/bjoc.19.146 Abstract Long oligodeoxynucleotides (ODNs) are segments of DNAs having over one hundred nucleotides (nt). They are typically assembled using enzymatic methods such as PCR and

• synthesized ODNs of 20–60 nt in length using PCR or ligation [8]. While these methods have made possible the emergence of research areas such as synthetic biology [9][10][11][12][13][14], they have various drawbacks [3]. (1) Owing to the short length of the starting ODNs, a large number of them are needed in

• the PCR assembly step. Because of this, misalignments may occur, and errors may be introduced. (2) PCR assembly of multiple short ODNs in one pot requires similar melting points of the multiple overlapping regions of the short ODNs. Therefore, the sequences of the short ODNs must be carefully chosen

Sulfur-containing spiroketals from Breynia disticha and evaluations of their anti-inflammatory effect

• Ken-ichi Nakashima,
• Naohito Abe,
• Masayoshi Oyama,
• Hiroko Murata and
• Makoto Inoue

Beilstein J. Org. Chem. 2023, 19, 1604–1614, doi:10.3762/bjoc.19.117

• compounds isolated in this study, we investigated the lipopolysaccharide (LPS)-induced production of proinflammatory cytokines – interleukin (IL)-1β, IL-6, and TNF-α – in RAW 264.7 murine macrophage cells by quantitative real-time polymerase chain reaction (qRT-PCR) analysis. The sulfur-containing

• appropriate concentrations by dissolving in DMSO and diluting 1000-fold in medium. RAW 264.7 cells were preincubated with fresh medium containing test samples or vehicle (DMSO) for 24 h. After preincubation, LPS was added at a final concentration of 50 ng/mL. qRT-PCR analysis Total RNA was extracted using

• RNAiso Plus (Takara Bio) after 2 h of LPS treatment. cDNA was obtained by reverse transcription from 0.3 µg of total RNA using the ReverTra Ace RT-qPCR Master Mix with gDNA remover (Toyobo). qRT-PCR analysis was performed using a StepOnePlus real-time PCR system (Thermo Fisher Scientific) with the

Functional characterisation of twelve terpene synthases from actinobacteria

• Anuj K. Chhalodia,
• Houchao Xu,
• Georges B. Tabekoueng,
• Binbin Gu,
• Kizerbo A. Taizoumbe,
• Lukas Lauterbach and
• Jeroen S. Dickschat

Beilstein J. Org. Chem. 2023, 19, 1386–1398, doi:10.3762/bjoc.19.100

• ). The genes coding for all fifteen enzymes were amplified by PCR from genomic DNA, cloned and expressed in Escherichia coli. The purified recombinant proteins (Figure S1, Supporting Information File 1) were used in test incubations with geranyl pyrophosphate (GPP), farnesyl pyrophosphate (FPP

New triazole-substituted triterpene derivatives exhibiting anti-RSV activity: synthesis, biological evaluation, and molecular modeling

• Elenilson F. da Silva,
• Krist Helen Antunes Fernandes,
• Denise Diedrich,
• Jessica Gotardi,
• Marcia Silvana Freire Franco,
• Carlos Henrique Tomich de Paula da Silva,
• Ana Paula Duarte de Souza and
• Simone Cristina Baggio Gnoatto

Beilstein J. Org. Chem. 2022, 18, 1524–1531, doi:10.3762/bjoc.18.161

• drug for its treatment, however, its clinical use has been limited due to its side effects. Here, we designed two new nitroaryl-1,2,3-triazole triterpene derivatives as novel anti-RSV drugs. Their anti-RSV and cytotoxic activity were evaluated in vitro, RSV protein F gene effects by RT-PCR and

• of compound 8 on RSV protein F gene expression was investigated using an RT-PCR assay. Total RNA was extracted from RSV-infected cells, both treated and untreated with compound 8 (12.5 and 50 µM). A real-time PCR was performed for the amplification of the RSV protein F gene using specific primers and

• with compound 8. (B) Viral load quantification by real-time PCR after treatment with compound 8. Superposition of the top-ranked docking solution of compound 8 (carbon atoms in yellow, in stick representation) with the crystallographic poses of IMP and inhibitor MAD1 (color by atoms in stick

A Streptomyces P450 enzyme dimerizes isoflavones from plants

• Run-Zhou Liu,
• Shanchong Chen and
• Lihan Zhang

Beilstein J. Org. Chem. 2022, 18, 1107–1115, doi:10.3762/bjoc.18.113

• ://www.geneious.com). Protein purification and biochemical assays The Streptomyces genome was extracted by TIANamp Bacteria DNA Kit (TIANGEN BIOTECH), and the P450 genes were amplified by PCR (Table S1, Supporting Information File 1) and cloned into a pET-28a(+) vector by the T5 exonuclease DNA assembly method [39

Isolation and biosynthesis of daturamycins from Streptomyces sp. KIB-H1544

• Yin Chen,
• Jinqiu Ren,
• Ruimin Yang,
• Jie Li,
• Sheng-Xiong Huang and
• Yijun Yan

Beilstein J. Org. Chem. 2022, 18, 1009–1016, doi:10.3762/bjoc.18.101

• in 20 96-well microplates at −80 °C. The positive clone, named pSC-21A4, was verified by PCR. And primers used for screening were listed in Table S3 (Supporting Information File 1). Gene inactivation Primers designed for inactivation of datA gene are listed in Table S3 (Supporting Information File 1

• ). The deletion mutant was constructed by λ-RED-mediated PCR targeting mutagenesis method [27]. The positive cosmid pSC-21A4 was transformed into E. coli BW25113/pIJ790 for gene inactivation. Then, the PCR fragment was introduced via electro-transformation into E. coli BW25113/pIJ790-pSC-21A4, in which

• mM MgCl2. Double crossover mutants were selected based on the Kan-Apr and then confirmed by PCR using primers. Finally, the mutant strain S. sp. KIB-H1544-∆datA was generated (Table S2, Supporting Information File 1). Expression and purification of recombinant DatA and EchA protein The DNA fragment

Anti-inflammatory aromadendrane- and cadinane-type sesquiterpenoids from the South China Sea sponge Acanthella cavernosa

• Shou-Mao Shen,
• Qing Yang,
• Yi Zang,
• Jia Li,
• Xueting Liu and
• Yue-Wei Guo

Beilstein J. Org. Chem. 2022, 18, 916–925, doi:10.3762/bjoc.18.91

• ) after being washed thrice with cold PBS. The total RNA (1 μg) was transcribed into cDNA in 20 μL reactions using the PrimeScript RT reagent kit (ABclonal, China) and then diluted to 200 μL. Real-time quantitative PCR (qPCR) was performed using SYBR GREEN QPCR KIT (Bimake, B21202) on Agilent Mx3000P

Efficient production of clerodane and ent-kaurane diterpenes through truncated artificial pathways in Escherichia coli

• Fang-Ru Li,
• Xiaoxu Lin,
• Qian Yang,
• Ning-Hua Tan and
• Liao-Bin Dong

Beilstein J. Org. Chem. 2022, 18, 881–888, doi:10.3762/bjoc.18.89

• primers designed from the sequences of cyc1 and cyc2, we fortunately obtained two genes of expected lengths, which we named tdps and ttes, by polymerase chain reaction (PCR). The sequencing results of tdps and ttes showed extremely high identities with those of cyc1 and cyc2 (97% and 99%, respectively

Identification of the new prenyltransferase Ubi-297 from marine bacteria and elucidation of its substrate specificity

• Jamshid Amiri Moghaddam,
• Huijuan Guo,
• Karsten Willing,
• Thomas Wichard and
• Christine Beemelmanns

Beilstein J. Org. Chem. 2022, 18, 722–731, doi:10.3762/bjoc.18.72

• pET28a(+) vectors were used, and E. coli BL21 was used as production host. Cultures were supplemented with ampicillin (100 µg mL−1) and kanamycin (60 µg mL−1) for the selection of plasmids. DNA isolation, PCR amplification, and cloning: gDNA of Maribacter sp. MS6 was extracted using DNeasy Blood & Tissue

• Kit (Qiagen) and PCR amplification of ubiA-297 (922 bp) and menA-1335 (952 bp) genes was carried out using S7 Fusion High-Fidelity DNA Polymerase (Biozym) and designated primer sequences (ubiA-297 forward 5’-CAGGATCCAGGATGTCCAATAAACTAATG-3’ reverse 5’-CGAAGCTTGTCTTAGGTAATGGCAAAAAG-3’; menA forward 5

• ’-CAGGATCCCCCTTACTAGTGAC-3’ and reverse 5’-GTAAGCTTGATGGTTGACATTC-3’). The obtained PCR fragments were ligated into a pJET 1.2 vector yielding plasmid pJET-297 and pJET-1335, which were sequenced to confirm integrity. To create the pET28-297 and pET28-1335 expression vector, pJET-297 and pJET-1335 were digested with BamHI

Volatile emission and biosynthesis in endophytic fungi colonizing black poplar leaves

• Christin Walther,
• Pamela Baumann,
• Katrin Luck,
• Beate Rothe,
• Peter H. W. Biedermann,
• Jonathan Gershenzon,
• Tobias G. Köllner and
• Sybille B. Unsicker

Beilstein J. Org. Chem. 2021, 17, 1698–1711, doi:10.3762/bjoc.17.118

• (Thermo Fisher Scientific). The template volume was adjusted to a final DNA concentration of approximately 500 ng/mL. Ultrapure water (Milli-Q® Synthesis A10) was added up to a final volume of 50 µL. PCR was performed in a gradient thermal cycler (Whatman Biometra 96T) using the following program

• : initiation and activation of polymerase (95 °C/5 min); followed by 35 cycles of denaturation (95 °C/30 s), annealing (65 °C/30 s) and elongation (72 °C/90 s) and a single, final elongation step (72 °C/10 min). For gel electrophoresis, 4 µL PCR product was mixed with one drop loading dye (0.3 mL 30% glycerol

• Scientific) for 30 min at 135 V (150 mA). The PCR products were purified with a QIAquick PCR purification kit (Qiagen, Hilden, Germany) following the manufacturer’s instructions. Purified PCR products were sequenced using the Sanger method on a ABI Prism® Gen-Analysator 3130xl (Applied Biosystems

Chemical approaches to discover the full potential of peptide nucleic acids in biomedical applications

• Nikita Brodyagin,
• Martins Katkevics,
• Venubabu Kotikam,
• Christopher A. Ryan and
• Eriks Rozners

Beilstein J. Org. Chem. 2021, 17, 1641–1688, doi:10.3762/bjoc.17.116

Double-headed nucleosides: Synthesis and applications

• Vineet Verma,
• Jyotirmoy Maity,
• Vipin K. Maikhuri,
• Ritika Sharma,
• Himal K. Ganguly and
• Ashok K. Prasad

Beilstein J. Org. Chem. 2021, 17, 1392–1439, doi:10.3762/bjoc.17.98

Analogs of the carotane antibiotic fulvoferruginin from submerged cultures of a Thai Marasmius sp.

• Birthe Sandargo,
• Leon Kaysan,
• Rémy B. Teponno,
• Christian Richter,
• Benjarong Thongbai,
• Frank Surup and
• Marc Stadler

Beilstein J. Org. Chem. 2021, 17, 1385–1391, doi:10.3762/bjoc.17.97

• manufacturer’s protocol. A Precellys 24 homogenizer (Bertin Technologies, France) at 6000 rpm for 2 × 40 s was used for cell disruption. DNA regions were amplified using standard primers following our previously published protocols [13]. For both DNA regions, the PCR products were purified utilizing the Nucleo

• Spin® Gel and PCR Clean-up kit (Macherey-Nagel, Düren, Germany). Sequencing of the PCR products was carried out at the Department of Genome Analytics of the Helmholtz Centre for Infection Research, Braunschweig, Germany. Fermentation and isolation of metabolites 1–6 Cultures of Marasmius sp. strain

Antiviral therapy in shrimp through plant virus VLP containing VP28 dsRNA against WSSV

• Santiago Ramos-Carreño,
• Ivone Giffard-Mena,
• Jose N. Zamudio-Ocadiz,
• Alfredo Nuñez-Rivera,
• Ricardo Valencia-Yañez,
• Jaime Ruiz-Garcia,
• Maria Teresa Viana and
• Ruben D. Cadena-Nava

Beilstein J. Org. Chem. 2021, 17, 1360–1373, doi:10.3762/bjoc.17.95

• pellets three times a day. Every four hours, moribund organisms were collected and euthanized using liquid nitrogen, and subsequently stored at −80 °C for further analysis. WSSV was confirmed by endpoint polymerase chain reaction (PCR), following Koch's postulates. Minimum infectious dose determination

• ). Pellets with VLP-dsRNAvp28 prepared with commercial binders (Dry Oil® and NutriKelp®) are described in Supporting Information File 1. Detection of WSSV by real-time quantitative PCR. The real-time PCR (qPCR) for quantitation of WSSV was performed using DNA isolated from shrimp muscle tissue and TaqMan

• quantitative PCR (qPCR). Average copies of WSSV in ng−1 and SD values of shrimp treated with coated and mixed pellets using industrial-grade fish oil (ap), salmon fish oil (aps), and commercial binders (DO and NK). Supporting Information Supporting Information File 32: Tables of detailed experimental assays

Semiautomated glycoproteomics data analysis workflow for maximized glycopeptide identification and reliable quantification

• Steffen Lippold,
• Arnoud H. de Ru,
• Jan Nouta,
• Peter A. van Veelen,
• Magnus Palmblad,
• Manfred Wuhrer and
• Noortje de Haan

Beilstein J. Org. Chem. 2020, 16, 3038–3051, doi:10.3762/bjoc.16.253

• agitation, the beads were washed three times with PBS and three times with water. The immunoglobulins were released by acid elution (100 mM formic acid) and collected into a 96-well PCR plate (Greiner Bio-One, Kremsmünster, Austria). Finally, the eluates were dried for 2.5 h at 60 °C by centrifugation under

Secondary metabolites of Bacillus subtilis impact the assembly of soil-derived semisynthetic bacterial communities

• Heiko T. Kiesewalter,
• Carlos N. Lozano-Andrade,
• Mikael L. Strube and
• Ákos T. Kovács

Beilstein J. Org. Chem. 2020, 16, 2983–2998, doi:10.3762/bjoc.16.248

• . Amplification of 16S rRNA hypervariable regions V3-V4 The V3-V4 region of the 16S rRNA gene was PCR-amplified from the extracted DNA samples using Fw_V3V4 (5’-CCTACGGGNGGCWGCAG-3’) and Rv_V3V4 (5’-GACTACHVGGGTATCTAATCC-3’) primers that were tagged with short barcodes with a length of eight nucleotides, listed

• in Table S2, Supporting Information File 1. The PCR reactions contained 10.6 μL DNase-free water, 12.5 μL TEMPase Hot Start 2x Master Mix, 0.8 μL of each primer (10 μM), and 0.3 μL of 50 ng/µL DNA template. The PCR was performed using the conditions of 95 °C for 15 min, followed by 30 cycles of 95 °C

• for 30 s, 62 °C for 30 s, 72 °C for 30 s, and finally, 72 °C for 5 min. All V3-V4 amplicons were purified using the NucleoSpin gel and PCR cleanup kit (Macherey-Nagel) and pooled in equimolar ratios. The amplicon pool was submitted to Novogene Europe Company Limited (United Kingdom) for high

Clustering and curation of electropherograms: an efficient method for analyzing large cohorts of capillary electrophoresis glycomic profiles for bioprocessing operations

• Ian Walsh,
• Matthew S. F. Choo,
• Sim Lyn Chiin,
• Amelia Mak,
• Shi Jie Tay,
• Pauline M. Rudd,
• Yang Yuansheng,
• Andre Choo,
• Ho Ying Swan and
• Terry Nguyen-Khuong

Beilstein J. Org. Chem. 2020, 16, 2087–2099, doi:10.3762/bjoc.16.176

• were made according to the manufacturer’s instructions. This protocol was adapted to a 96-well PCR plate. Two hundred (200 µL) of magnetic beads were used per 100 µg of glycoprotein. The magnetic bead storage solution was removed using a plate magnet. Antibodies of 100 µg in 10 µL (10 µg/µL) aliquots

Emission and biosynthesis of volatile terpenoids from the plasmodial slime mold Physarum polycephalum

• Xinlu Chen,
• Tobias G. Köllner,
• Wangdan Xiong,
• Guo Wei and
• Feng Chen

Beilstein J. Org. Chem. 2019, 15, 2872–2880, doi:10.3762/bjoc.15.281

• To determine whether PpolyTPS genes encode functional terpene synthases, full-length cDNAs were amplified by RT-PCR and cloned into the protein expression vector pEXP-5-CT/TOPO. Recombinant PpolyTPSs were heterologously expressed in Escherichia coli and then tested for terpene synthase activities

Genome mining in Trichoderma viride J1-030: discovery and identification of novel sesquiterpene synthase and its products

• Xiang Sun,
• You-Sheng Cai,
• Yujie Yuan,
• Guangkai Bian,
• Ziling Ye,
• Zixin Deng and
• Tiangang Liu

Beilstein J. Org. Chem. 2019, 15, 2052–2058, doi:10.3762/bjoc.15.202

• synthase well-identified with products characterised in T. viride. In vitro analysis of Tvi09626 function To confirm the function of the candidate enzyme, the DNA sequence of Tvi09626 was amplified by touchdown PCR from the T. viride genome. The gene fragment was cloned into a pET28a (+) vector to

New terpenoids from the fermentation broth of the edible mushroom Cyclocybe aegerita

• Frank Surup,
• Florian Hennicke,
• Nadine Sella,
• Maria Stroot,
• Steffen Bernecker,
• Sebastian Pfütze,
• Marc Stadler and
• Martin Rühl

Beilstein J. Org. Chem. 2019, 15, 1000–1007, doi:10.3762/bjoc.15.98

• spectrometry and NMR spectroscopy. The relative configurations of 2–4 were assigned by ROESY correlations, and 3JH,H coupling constants in the case of 4. Applying quantitative PCR for gene expression validation, we linked the production of bovistol and its derivatives to the respective biosynthesis gene

• performed in triplicates using the CFX Connect™ RT-PCR Detection System (Bio-Rad Laboratories, Hercules, CA, USA). The following conditions were applied: enzyme activation at 94 °C for 20 s followed by 40 cycles of 94 °C for 30 s, 58 °C for 30 s and 72 °C for 10 s. Structures of the isolated metabolites

Thermophilic phosphoribosyltransferases Thermus thermophilus HB27 in nucleotide synthesis

• Ilja V. Fateev,
• Ekaterina V. Sinitsina,
• Aiguzel U. Bikanasova,
• Maria A. Kostromina,
• Elena S. Tuzova,
• Larisa V. Esipova,
• Tatiana I. Muravyova,
• Alexei L. Kayushin,
• Irina D. Konstantinova and
• Roman S. Esipov

Beilstein J. Org. Chem. 2018, 14, 3098–3105, doi:10.3762/bjoc.14.289

• . thermophilus HB27 strain by a polymerase chain reaction (PCR) using synthetic primers. The genes were cloned into the expression vectors pET-23a+ and pET-23d+ respectively. The E. coli strains BL21(DE3)/pER- TthAPRT and C3030/pER- TthHPRT produced the target enzymes mainly in soluble form (culturing conditions