Search results

Search for "templates" in Full Text gives 97 result(s) in Beilstein Journal of Organic Chemistry.

DNA functionalization by dynamic chemistry

  • Zeynep Kanlidere,
  • Oleg Jochim,
  • Marta Cal and
  • Ulf Diederichsen

Beilstein J. Org. Chem. 2016, 12, 2136–2144, doi:10.3762/bjoc.12.203

Graphical Abstract
  • oligonucleotides. The amino group containing phosphoramidite was used together with complementary single-strand DNA templates that influenced the Watson–Crick base-pairing equilibrium in the mixture with a set of aldehyde modified nucleobases. A significant fraction of all possible base-pair mismatches was
  • analogue. Keywords: base-pairing; base-pair mismatch; DNA functionalization; DNA templates; dynamic combinatorial chemistry; D-threoninol based scaffolds; Introduction The well-defined duplex structure, self-assembling by base-pair recognition, and the accessibility by solid-phase synthesis make DNA
  • . Here we synthesized the phosphoramidite building blocks derived from D-threoninol which contain protected amine or thiol groups. These building blocks are used for later incorporation into oligonucleotides via solid-phase synthesis. Using these modified oligonucleotides and single strand DNA templates
PDF
Album
Supp Info
Full Research Paper
Published 06 Oct 2016

Biosynthesis of oxygen and nitrogen-containing heterocycles in polyketides

  • Franziska Hemmerling and
  • Frank Hahn

Beilstein J. Org. Chem. 2016, 12, 1512–1550, doi:10.3762/bjoc.12.148

Graphical Abstract
  • templates particular cyclisation patterns. The fact that PieC was dispensable for piericidin A1 (221) biosynthesis was explained by that it could either be complemented by other endogenous cyclases in S. piomogeues or that the thermodynamically favoured formation of the six-membered heterocycle occurs
PDF
Album
Review
Published 20 Jul 2016

Application of Cu(I)-catalyzed azide–alkyne cycloaddition for the design and synthesis of sequence specific probes targeting double-stranded DNA

  • Svetlana V. Vasilyeva,
  • Vyacheslav V. Filichev and
  • Alexandre S. Boutorine

Beilstein J. Org. Chem. 2016, 12, 1348–1360, doi:10.3762/bjoc.12.128

Graphical Abstract
  • was used for their final purification. DNA-templated synthesis of TFO-MGB conjugates It has been shown that the presence of copper ions does not prevent duplex and triplex formation and the DNA-directed cycloaddition reaction proceed smoothly on these templates [38]. In 2003, the team of P. Dervan
PDF
Album
Supp Info
Full Research Paper
Published 30 Jun 2016

1H-Imidazol-4(5H)-ones and thiazol-4(5H)-ones as emerging pronucleophiles in asymmetric catalysis

  • Antonia Mielgo and
  • Claudio Palomo

Beilstein J. Org. Chem. 2016, 12, 918–936, doi:10.3762/bjoc.12.90

Graphical Abstract
  • = S) analogues of these oxazol-4(5H)-ones have been demonstrated to be very interesting templates in asymmetric catalysis. In these cases the hydrolysis of the adducts coming from an asymmetric reaction can provide enantioenriched α-hydroxy acids (X = O), N-substituted α-amino acids (X = NR’) or α
  • ]. The main advantages of these pronucleophiles over the previous known templates are: i) the NR group can be installed in the heterocycle previous to the asymmetric reaction, ii) they are easily deprotonated under soft enolization conditions (aromatic enolate formation), and iii) unlike azlactones and
  • the reactions with the α’-hydroxyenone provided the adducts in very poor enantioselectivity. This is a particular and interesting characteristic of these templates because the α-hydroxy group can be transformed into other oxy derivatives to better adapt to the most suitable substrate/catalyst
PDF
Album
Review
Published 09 May 2016

Synthesis and in vitro cytotoxicity of acetylated 3-fluoro, 4-fluoro and 3,4-difluoro analogs of D-glucosamine and D-galactosamine

  • Štěpán Horník,
  • Lucie Červenková Šťastná,
  • Petra Cuřínová,
  • Jan Sýkora,
  • Kateřina Káňová,
  • Roman Hrstka,
  • Ivana Císařová,
  • Martin Dračínský and
  • Jindřich Karban

Beilstein J. Org. Chem. 2016, 12, 750–759, doi:10.3762/bjoc.12.75

Graphical Abstract
  • for a variety of acylated (nonfluorinated) D-mannosamine and D-glucosamine derivatives [62][63]. Acylated hexosamine derivatives were subsequently studied as possible templates for the development of anticancer therapeutics [64][65]. While the ability of hexosamine derivatives and analogs to inhibit
PDF
Album
Supp Info
Full Research Paper
Published 20 Apr 2016

From steroids to aqueous supramolecular chemistry: an autobiographical career review

  • Bruce C. Gibb

Beilstein J. Org. Chem. 2016, 12, 684–701, doi:10.3762/bjoc.12.69

Graphical Abstract
  • to be useful hosts, these deep-cavity cavitands also demonstrated that resorcinarenes could be used as covalent templates to form macrocycles. For example, the deep-cavity cavitand shown in Scheme 8 can be treated with excess BBr3 to cleave the four, benzal-bridges and liberate a new family of
PDF
Album
Review
Published 12 Apr 2016

Creating molecular macrocycles for anion recognition

  • Amar H. Flood

Beilstein J. Org. Chem. 2016, 12, 611–627, doi:10.3762/bjoc.12.60

Graphical Abstract
  • cyanostar macrocycles is still being explored. The large binding pockets and the C5 symmetry provide a basis for a lot of new chemistry. This includes use of phosphodiesters as templates for the synthesis of [3]rotaxanes [7] (Figure 13). The other aspect of these macrocycles arising from their π surface is
PDF
Album
Review
Published 31 Mar 2016

My maize and blue brick road to physical organic chemistry in materials

  • Anne J. McNeil

Beilstein J. Org. Chem. 2016, 12, 229–238, doi:10.3762/bjoc.12.24

Graphical Abstract
  • templates for synthesizing materials with high surface areas. The future of molecular gels remains bright. Two areas of growing importance include: (i) applying advanced solid-state characterization methods to gain insight into the molecular packing within gel fibers, and (ii) efforts towards correlating
PDF
Album
Review
Published 08 Feb 2016

Assembly of synthetic Aβ miniamyloids on polyol templates

  • Sebastian Nils Fischer and
  • Armin Geyer

Beilstein J. Org. Chem. 2015, 11, 2646–2653, doi:10.3762/bjoc.11.284

Graphical Abstract
  • , Aβ peptide pentapeptide boronic acids 1 and 2 were synthesized by solid-phase peptide synthesis and studied in esterification experiments with polyhydroxylated templates. The bis-hydroxylated dipeptide Hot=Tap serves as a template of adjustable degree of oligomerization which spontaneously forms
  • molecular weights in the region of several kilodalton. Sugars (polyols) were already investigated as templates for peptides [6] and vice versa [7] but both concepts were not yet used for the assembly of monodisperse Aβ miniamyloids. Lehn’s concept of constitutional dynamic chemistry (CDC) [8][9] relies on
  • avoided only when two different reactive groups are employed; that is why the reversible esterification between boronic acids and diols appeared an attractive solution to us. In a first approach, we planned to condense short peptide boronic acids with polyol templates for the assembly of an Aβ-dimer. The
PDF
Album
Supp Info
Full Research Paper
Published 17 Dec 2015

Aggregation behaviour of amphiphilic cyclodextrins: the nucleation stage by atomistic molecular dynamics simulations

  • Giuseppina Raffaini,
  • Antonino Mazzaglia and
  • Fabio Ganazzoli

Beilstein J. Org. Chem. 2015, 11, 2459–2473, doi:10.3762/bjoc.11.267

Graphical Abstract
  • summarizes the main results with an outlook to future work. Simulation Method The simulations were performed with InsightII/Discover 2000 [44], using the consistent valence force field CVFF [45] as previously done [35][39][40][46]. The geometry of the model aCD, generated with the available templates of
PDF
Album
Supp Info
Full Research Paper
Published 07 Dec 2015

Preparation of Pickering emulsions through interfacial adsorption by soft cyclodextrin nanogels

  • Shintaro Kawano,
  • Toshiyuki Kida,
  • Mitsuru Akashi,
  • Hirofumi Sato,
  • Motohiro Shizuma and
  • Daisuke Ono

Beilstein J. Org. Chem. 2015, 11, 2355–2364, doi:10.3762/bjoc.11.257

Graphical Abstract
  • crosslinked polymers, have recently been demonstrated as Pickering emulsifiers with pH or thermo-responsive properties [7][8][9]. Such emulsions have potential in pharmaceutical, food, and cosmetic products. Moreover, emulsions stabilized by stimuli-responsive soft microgels should be applicable as templates
PDF
Album
Supp Info
Full Research Paper
Published 30 Nov 2015

Synthesis of photoresponsive cholesterol-based azobenzene organogels: dependence on different spacer lengths

  • Yuchun Ren,
  • Bin Wang and
  • Xiuqing Zhang

Beilstein J. Org. Chem. 2015, 11, 1089–1095, doi:10.3762/bjoc.11.122

Graphical Abstract
  • ; organogel; photoresponsive; Introduction In the past few decades, low molecular mass organic gelators (LMOGs) have attracted increasing attention not only for basic self-assembly behavior but also for their potential application in areas such as templates [1], light harvesting [2], fluorescent scensing [3
PDF
Album
Supp Info
Full Research Paper
Published 29 Jun 2015

Orthogonal dual-modification of proteins for the engineering of multivalent protein scaffolds

  • Michaela Mühlberg,
  • Michael G. Hoesl,
  • Christian Kuehne,
  • Jens Dernedde,
  • Nediljko Budisa and
  • Christian P. R. Hackenberger

Beilstein J. Org. Chem. 2015, 11, 784–791, doi:10.3762/bjoc.11.88

Graphical Abstract
  • use of chemical labeling methods to study structure and function of proteins in vitro and in vivo, chemoselective conjugation techniques are also used to functionalize artificial protein scaffolds, such as viral capsids [5][6][7]. Such templates have self-assembled hierarchical structures that allow
PDF
Album
Supp Info
Full Research Paper
Published 13 May 2015

DNA display of glycoconjugates to emulate oligomeric interactions of glycans

  • Alexandre Novoa and
  • Nicolas Winssinger

Beilstein J. Org. Chem. 2015, 11, 707–719, doi:10.3762/bjoc.11.81

Graphical Abstract
  • different chemistries used in the glycoconjugations and the different strategies used to display the glycans with DNA templates. Review Glycan–DNA conjugates An initial solution used in the pioneering work of Kobayashi [17] for nucleic acid–glycan conjugation was the chemoselective reaction of p
  • in the glycans. DC-SIGN is a tetrameric lectin implicated in interactions with a broad array of pathogens including HIV. A library of 37,485 assemblies was prepared by hybridization of two sets of PNA-tagged glycoconjugates onto a library of DNA templates (Figure 4). Screening the library by affinity
  • set of five different glycan–PNA conjugates and different DNA templates, the optimal spatial arrangement of the ligands was systematically investigated. Additionally, the flexibility of the PNA–DNA duplexes was also modulated by introducing nick-sites and partially unpaired regions in the DNA display
PDF
Album
Review
Published 11 May 2015

IR and electrochemical synthesis and characterization of thin films of PEDOT grown on platinum single crystal electrodes in [EMMIM]Tf2N ionic liquid

  • Andrea P. Sandoval,
  • Marco F. Suárez-Herrera and
  • Juan M. Feliu

Beilstein J. Org. Chem. 2015, 11, 348–357, doi:10.3762/bjoc.11.40

Graphical Abstract
  • ) < Pt(110) < Pt(111) [6]. The synthesis of other conducting polymers on well-defined surfaces [7][8][9][10] and templates [11] also has shown how the surface affects their adhesion, coverage, morphology and redox kinetics. On the other hand, the synthesis of conducting polymers in ionic liquids (ILs
PDF
Album
Full Research Paper
Published 13 Mar 2015

Morita–Baylis–Hillman reaction of acrylamide with isatin derivatives

  • Radhey M. Singh,
  • Kishor Chandra Bharadwaj and
  • Dharmendra Kumar Tiwari

Beilstein J. Org. Chem. 2014, 10, 2975–2980, doi:10.3762/bjoc.10.315

Graphical Abstract
  • . This is especially relevant given the fact that they have been extensively used in drug design [23][24], polymer chemistry [25][26] and are popular synthetic templates [27][28]. For further comparison to other acryl systems, acrylamide also offers extra valencies at nitrogen, which can be used for
PDF
Album
Supp Info
Full Research Paper
Published 12 Dec 2014

A new charge-tagged proline-based organocatalyst for mechanistic studies using electrospray mass spectrometry

  • J. Alexander Willms,
  • Rita Beel,
  • Martin L. Schmidt,
  • Christian Mundt and
  • Marianne Engeser

Beilstein J. Org. Chem. 2014, 10, 2027–2037, doi:10.3762/bjoc.10.211

Graphical Abstract
  • proline catalyst 1. Proposed catalytic cycle [36][37][38] for the aldol reaction with aldehyde donors [54]; CT = charge tag, a: R = Ph, b: R = Et. Acknowledgements Financial support from the DFG (SFB 624 “templates”) is gratefully acknowledged. We thank Charlotte Rödde and Dr. Gregor Schnakenburg for the
PDF
Album
Full Research Paper
Published 28 Aug 2014

Theoretical study of the adsorption of benzene on coinage metals

  • Werner Reckien,
  • Melanie Eggers and
  • Thomas Bredow

Beilstein J. Org. Chem. 2014, 10, 1775–1784, doi:10.3762/bjoc.10.185

Graphical Abstract
  • surfaces. Acknowledgements Financial support by DFG in the framework of the collaborative research center SFB 624 “Templates” at the University of Bonn is gratefully acknowledged.
PDF
Album
Supp Info
Full Research Paper
Published 04 Aug 2014

Chemical templates

  • Sigurd Höger

Beilstein J. Org. Chem. 2014, 10, 1670–1671, doi:10.3762/bjoc.10.174

Graphical Abstract
  • in a stoichiometric or a catalytic way, it can be reused or remain in the product as an integral part. Template effects in chemistry are commonly associated with the formation of (macro)cycles, or covalent bond formation in general. However, chemical templates can also exert a variety of other
  • planar substrate with a specific structure and composition, determines the respective pattern formation on its surface. And three-dimensional templates are a unique and versatile tool for providing well-designed volume structures, often decorated with useful functionality. Not surprisingly, the annual
PDF
Editorial
Published 22 Jul 2014

Substitution effect and effect of axle’s flexibility at (pseudo-)rotaxanes

  • Friedrich Malberg,
  • Jan Gerit Brandenburg,
  • Werner Reckien,
  • Oldamur Hollóczki,
  • Stefan Grimme and
  • Barbara Kirchner

Beilstein J. Org. Chem. 2014, 10, 1299–1307, doi:10.3762/bjoc.10.131

Graphical Abstract
  • differences such as substitution or dealkylation. Acknowledgements We would like to thank the DFG in the framework of the collaborative research center SFB 624 “Templates” at the University of Bonn for the funding of this research. Furthermore, the financial support of the DFG project KI 768/7-1 is gratefully
PDF
Album
Supp Info
Full Research Paper
Published 05 Jun 2014

Molecular architecture with carbohydrate functionalized β-peptides adopting 314-helical conformation

  • Nitin J. Pawar,
  • Navdeep S. Sidhu,
  • George M. Sheldrick,
  • Dilip D. Dhavale and
  • Ulf Diederichsen

Beilstein J. Org. Chem. 2014, 10, 948–955, doi:10.3762/bjoc.10.93

Graphical Abstract
  • cooperative effects. To evaluate carbohydrate interaction and recognition, the structurally defined attachment of sugar units to a rigid template is highly desired. β-Peptide helices offer conformationally stable templates for the linear presentation of sugar units in defined distances. The synthesis and β
  • , galactose and xylose derivatives were incorporated as sugar units in rigid peptide templates. Keeping the proper β3-configuration for getting a β-peptide 314-helix (2–6) the isopropylidene protecting group and an anomeric acetal are structurally well tolerated. An additional perspective emerged from the
PDF
Album
Supp Info
Full Research Paper
Published 28 Apr 2014

The influence of intraannular templates on the liquid crystallinity of shape-persistent macrocycles

  • Joscha Vollmeyer,
  • Ute Baumeister and
  • Sigurd Höger

Beilstein J. Org. Chem. 2014, 10, 910–920, doi:10.3762/bjoc.10.89

Graphical Abstract
  • intraannular bridges serve in this case as templates that reduce the oligomerization even when the reaction is not performed under pseudo high-dilution conditions. The extraannular as well as the intraannular substituents have a strong influence on the thermal behavior of the compounds. With branched alkyl
  • planar. Keywords: discotic liquid crystals; shape-persistent macrocycles; templates; X-ray scattering; Introduction The supramolecular chemistry of shape-persistent macrocycles has enormously expanded during the past several years [1][2][3][4][5][6]. It covers the non-covalent interaction between the
  • non-covalently or covalently bound to the bisacetylenes [45][49][50]. The template does not necessarily only support the desired cyclization, it can also take over an active function in the final target structure. Covalently attached templates have the advantage over most of the supramolecular
PDF
Album
Supp Info
Full Research Paper
Published 23 Apr 2014

Molecular recognition of isomeric protonated amino acid esters monitored by ESI-mass spectrometry

  • Andrea Liesenfeld and
  • Arne Lützen

Beilstein J. Org. Chem. 2014, 10, 825–831, doi:10.3762/bjoc.10.78

Graphical Abstract
  • two new templates based on a 9,9’-spirobifluorene core and tested them with regard to their ability to recognize the three isomeric amino acids in form of their protonated methyl esters. We decided to use ESI-mass spectrometry for these tests since this technique is fast to perform, consumes only
  • trace amounts of material, and can be used to explore competitive experiments that are difficult to perform using UV–vis or NMR spectroscopy. Results and Discussion Design and synthesis of the concave templates Ammonium ions exhibit strong binding affinity towards crown ether moieties. Hence, we decided
  • non-polar parts of the substrates, e.g., via attractive dispersive interactions, or provide steric hindrance that prevents substrates of a certain shape to be accommodated in the concave binding site of the templates. Since the 9,9’-spirobifluorene moiety provides such a rigid concave, non-polar
PDF
Album
Supp Info
Full Research Paper
Published 09 Apr 2014

Self-assembly of metallosupramolecular rhombi from chiral concave 9,9’-spirobifluorene-derived bis(pyridine) ligands

  • Rainer Hovorka,
  • Sophie Hytteballe,
  • Torsten Piehler,
  • Georg Meyer-Eppler,
  • Filip Topić,
  • Kari Rissanen,
  • Marianne Engeser and
  • Arne Lützen

Beilstein J. Org. Chem. 2014, 10, 432–441, doi:10.3762/bjoc.10.40

Graphical Abstract
  • , University of Jyväskylä, P.O. Box 35, 40014 Jyväskylä, Finland 10.3762/bjoc.10.40 Abstract Two new 9,9’-spirobifluorene-based bis(4-pyridines) were synthesised in enantiopure and one also in racemic form. These ligands act as concave templates and form metallosupramolecular [(dppp)2M2L2] rhombi with cis
  • . Keywords: concave templates; metal complexes; self-assembly; self-sorting; 9,9’-spirobifluorene; supramolecular chemistry; Introduction Concave templates are versatile tools to achieve self-sorting behaviour in the self-assembly of defined aggregates from multicomponent mixtures in a social self
  • far we have studied templates based on the Tröger’s base [27] and the 2,2’-dihydroxybinaphthyl (BINOL) [28] scaffold and identified the bend angle of these V-shaped compounds to be a critical factor for the degree of self-sorting that can be achieved [9][15][16][17][18][25][26][27][28]. The 9,9
PDF
Album
Supp Info
Full Research Paper
Published 18 Feb 2014

Intermediates in monensin biosynthesis: A late step in biosynthesis of the polyether ionophore monensin is crucial for the integrity of cation binding

  • Wolfgang Hüttel,
  • Jonathan B. Spencer and
  • Peter F. Leadlay

Beilstein J. Org. Chem. 2014, 10, 361–368, doi:10.3762/bjoc.10.34

Graphical Abstract
  • : CGCGAATTCTCATGTTTGACCGCTTA TCATCGATAAGCTTTCCCGCCAGCCTCGCAGAG; SCAT2rev: CACCGGAAGGAGCTGACTGGGTTGAAGGCTC TCAAGGGCGAAGTTCCTATACTTTCTA. The cosmids Cos2 (monE) and Cos11 (monD) from a cosmid library of S. cinnamonensis [16] were used as templates for PCR. All mutants were verified by sequencing on both forward and reverse
PDF
Album
Letter
Published 10 Feb 2014
Other Beilstein-Institut Open Science Activities