Structure/affinity studies in the bicyclo-DNA series: Synthesis and properties of oligonucleotides containing bc^en-T and iso-tricyclo-T nucleosides

• Branislav Dugovic,
• Michael Wagner and
• Christian J. Leumann

Beilstein J. Org. Chem. 2014, 10, 1840–1847, doi:10.3762/bjoc.10.194

• ; Introduction Antisense oligonucleotides (ASOs) can interfere with gene expression via various biological mechanisms, depending on the nature of the cellular RNA target [1]. First and foremost they can inhibit translation by targeting a mature mRNA in either its coding or non-coding part of the sequence by a

• steric block or an RNase H dependent degradation mechanism. Furthermore, it has recently been shown that ASOs can alter RNA splicing when targeting exon/intron junctions or splice enhancer or silencer binding sites on pre-mRNAs, thus leading to alternative splicing [2][3], to exon skipping [4][5] or to

• growing number of micro RNAs (miRNAs) that are involved in genetic and epigenetic regulation of gene expression. Their misregulation stays at the onset of various forms of cancer and other metabolic diseases, and targeting of such miRNAs with ASOs (antimirs or anatagomirs) has been shown in the recent

Efficient routes toward the synthesis of the D-rhamno-trisaccharide related to the A-band polysaccharide of Pseudomonas aeruginosa

• Aritra Chaudhury,
• Sajal K. Maity and
• Rina Ghosh

Beilstein J. Org. Chem. 2014, 10, 1488–1494, doi:10.3762/bjoc.10.153

• and O-6 positions but also sets up the model on which various deoxygenation protocols may be tried. The linkage pattern and stereochemistry at the glycosidic positions on the target dictate the presence of acyl protection on the O-2 position as shown in Scheme 1. We began our synthesis targeting two

Carbohydrate PEGylation, an approach to improve pharmacological potency

• M. Eugenia Giorgi,
• Rosalía Agusti and
• Rosa M. de Lederkremer

Beilstein J. Org. Chem. 2014, 10, 1433–1444, doi:10.3762/bjoc.10.147

• increase solubility [8], prolong the in vivo action [9] or for targeting drug delivery [10] has been described. The potent anti-inflammatory drug dexamethasone was coupled to a multifunctional PEG, prepared by a click reaction, for treatment of rheumatoid arthritis [11]. A heterobifunctional PEG has been

• conjugated with both paclitaxel, a potent anticancer drug, and alendronate, a bone-targeting biphosphonate, in order to obtain strong bone tropism and fast drug release [12]. An enzymatic method using a microbial transglutaminase was described for PEGylation of human growth hormone [13]. Glycans have been

• by the use of a [3 + 2] cycloaddition reaction of an alkyne-bearing PEG reagent and an azide-functionalized tyrosine residue genetically incorporated on human superoxide dismutase-1 [30]. GlycoPEGylation, targeting carbohydrate sites, was conceived to produce a more homogeneous product with lower

Glycosystems in nanotechnology: Gold glyconanoparticles as carrier for anti-HIV prodrugs

• Fabrizio Chiodo,
• Marco Marradi,
• Javier Calvo,
• Eloisa Yuste and
• Soledad Penadés

Beilstein J. Org. Chem. 2014, 10, 1339–1346, doi:10.3762/bjoc.10.136

• application of gold nanoparticles as a DDS is an expanding field due to the inert properties of the gold core, their controlled fabrication, and multifunctionality [14]. This last property allows the design of particles simultaneously containing multiple chemotherapeutics and targeting moieties. Few studies

• ]. Our methodology for preparing GNPs allows the construction of particles simultaneously containing carbohydrates, peptides and targeting molecules in a controled way [21]. The use of biocompatible gold glyconanoparticles as scaffolds for the antiviral drugs could bring some important benefits such as

Human dendritic cell activation induced by a permannosylated dendron containing an antigenic GM₃-lactone mimetic

• Renato Ribeiro-Viana,
• Elena Bonechi,
• Javier Rojo,
• Clara Ballerini,
• Giuseppina Comito,
• Barbara Richichi and
• Cristina Nativi

Beilstein J. Org. Chem. 2014, 10, 1317–1324, doi:10.3762/bjoc.10.133

• residues of mannose for DC targeting and one residue of an immunogenic mimetic of a carbohydrate melanoma associated antigen. The immunological assays demonstrated that the glycodendron 5 is able to induce human immature DC activation in terms of a phenotype expression of co-stimulatory molecules

• expression and MHCII. Furthermore, DCs activated by the glycodendron 5 stimulate T lymphocytes to proliferate in a mixed lymphocytes reaction (MLR). Keywords: cancer immunotherapy; DC-SIGN; DC targeting; glycodendron; GM3-lactone mimetic; multivalent glycosystems; multivalent interactions; Introduction

• strategies is to arm DCs with tumor-specific antigens. This issue has successfully been achieved by either culturing ex vivo DCs [16][17] from bone marrow precursors or more recently by targeting in vivo DC receptors with specific mAbs conjugated to tumor antigens [18][19]. In both cases, the development of

Synthesis, characterization and DNA interaction studies of new triptycene derivatives

• Sourav Chakraborty,
• Snehasish Mondal,
• Rina Kumari,
• Sourav Bhowmick,
• Prolay Das and
• Neeladri Das

Beilstein J. Org. Chem. 2014, 10, 1290–1298, doi:10.3762/bjoc.10.130

• functionalities) with DNA. According to a literature survey, many metal-free small molecules are known to modify structural organization of DNA through recognition, binding, cleavage or crosslinking and reportedly have widespread applications in biology [26]. Targeting of DNA by several DNA-damaging agents have

Atherton–Todd reaction: mechanism, scope and applications

• Stéphanie S. Le Corre,
• Mathieu Berchel,
• Hélène Couthon-Gourvès,
• Jean-Pierre Haelters and
• Paul-Alain Jaffrès

Beilstein J. Org. Chem. 2014, 10, 1166–1196, doi:10.3762/bjoc.10.117

Polyglycerol-functionalized nanodiamond as a platform for gene delivery: Derivatization, characterization, and hybridization with DNA

• Li Zhao,
• Yuki Nakae,
• Hongmei Qin,
• Tadamasa Ito,
• Takahide Kimura,
• Hideto Kojima,
• Lawrence Chan and
• Naoki Komatsu

Beilstein J. Org. Chem. 2014, 10, 707–713, doi:10.3762/bjoc.10.64

• immobilize DNA, more functions such as enough dispersibility and targeting efficacy are required to use ND in vivo as a gene vector. Therefore, a more reliable and general process is desired to add sufficient functions for ND-based gene vectors. Herein a conjugation of ND-PG with basic polypeptides (Arg8

Synthesis of (2S,3R)-3-amino-2-hydroxydecanoic acid and its enantiomer: a non-proteinogenic amino acid segment of the linear pentapeptide microginin

• Rajendra S. Rohokale and
• Dilip D. Dhavale

Beilstein J. Org. Chem. 2014, 10, 667–671, doi:10.3762/bjoc.10.59

• ]. While targeting the synthesis of 2a, the Wittig olefination of 3a with n-hexyltriphenylphosphonium bromide and t-BuOK gave olefin 4a as a diasteromeric mixture of Z and E-isomers in the ratio 9.5:0.5 as shown by 1H NMR of the crude product. The catalytic hydrogenation of alkene 4a with 10% Pd/C in

New sesquiterpene hydroquinones from the Caribbean sponge Aka coralliphagum

• Qun Göthel and
• Matthias Köck

Beilstein J. Org. Chem. 2014, 10, 613–621, doi:10.3762/bjoc.10.52

• , targeting cell lines L929 mouse fibroblasts, KB-31 epidermoid carcinoma, MCF-7 breast cancer, and FS4-LTM conditional immortalization human fibroblasts, respectively. The FS4-LTM cell line was incubated for 24 hours with the tested substances. The other cell lines were incubated for 5 days with the tested

Preparation of new alkyne-modified ansamitocins by mutasynthesis

• Kirsten Harmrolfs,
• Lena Mancuso,
• Binia Drung,
• Florenz Sasse and
• Andreas Kirschning

Beilstein J. Org. Chem. 2014, 10, 535–543, doi:10.3762/bjoc.10.49

• introduce a thiol linker by Huisgen-type cycloaddition which can principally be utilized to create tumor targeting conjugates. In bioactivity tests, only those new ansamitocin derivatives showed strong antiproliferative activity that bear an ester side chain at C-3. Keywords: ansamitocins; antibiotics

• /ansamitocin conjugates [28] (Scheme 2). Bromo-ansamitocin 6 was obtained by mutasynthesis and was synthetically modified to the complex folic acid/drug conjugate 7. The vitamin folic acid has become a promising ligand for selectively targeting the folate receptor (FR) in cancer tissues where the FR is known

• antiproliferative activity of the “click” product 27c is remarkable as it demonstrates that substantial structural changes at C20 of the ansamitocins are tolerated and thus alkyne substituents open up diverse opportunities to diversify that position as reported including the introduction of tumor targeting ligands

Intermediates in monensin biosynthesis: A late step in biosynthesis of the polyether ionophore monensin is crucial for the integrity of cation binding

• Wolfgang Hüttel,
• Jonathan B. Spencer and
• Peter F. Leadlay

Beilstein J. Org. Chem. 2014, 10, 361–368, doi:10.3762/bjoc.10.34

• the S. cinnamonensis strain A519 [19] Redirect©-PCR-targeting technology was used according to the supplier's instructions [21][42]. The disruption cassettes were amplified from a HinDIII-EcoRI-fragment of pIJ773 with the following primers (5' to 3') monD: oD1for: CGGCCGCCACATTCCCCGACCTGGT

Recent applications of the divinylcyclopropane–cycloheptadiene rearrangement in organic synthesis

• Sebastian Krüger and
• Tanja Gaich

Beilstein J. Org. Chem. 2014, 10, 163–193, doi:10.3762/bjoc.10.14

• . Gaich et al. [38][39] used the DVCPR in a biosynthetic investigation targeting the dimethylallyltryptophan synthase. In order to test the biosynthetic hypothesis of the mode of action of the 4-prenylation of indoles by Arigoni and Wenkert (starting from L-tryptophan and dimethylallyl pyrophosphate

Synthesis and biological activity of N-substituted-tetrahydro-γ-carbolines containing peptide residues

• Nadezhda V. Sokolova,
• Valentine G. Nenajdenko,
• Vladimir B. Sokolov,
• Daria V. Vinogradova,
• Elena F. Shevtsova,
• Ludmila G. Dubova and
• Sergey O. Bachurin

Beilstein J. Org. Chem. 2014, 10, 155–162, doi:10.3762/bjoc.10.13

• view, mitochondria and the MPT process are very attractive targets for the search of new neuroprotective agents [4][5]. Several promising mitochondria-targeting neuroprotectors have been reported in the literature. Thus, the antihistaminic drug dimebon [6][7], which relates to tetrahydro-γ-carboline

• derivatives, has been found to stabilize and improve mitochondrial functions in different in vivo and in vitro models [8][9] (Figure 1). Another promising class of neuroprotectors are cell-permeable mitochondria-targeting synthetic small peptides, for example, the SS (Szeto–Schiller) peptide antioxidants [10

Studies toward bivalent κ opioids derived from salvinorin A: heteromethylation of the furan ring reduces affinity

• Thomas A. Munro,
• Wei Xu,
• Douglas M. Ho,
• Lee-Yuan Liu-Chen and
• Bruce M. Cohen

Beilstein J. Org. Chem. 2013, 9, 2916–2924, doi:10.3762/bjoc.9.328

• ligands with a furanylmethyl substituent (Figure 3), we decided to use a short linker. As an alternative approach, bivalent ligands with much longer linkers can bind simultaneously to both protomers in a receptor dimer, allowing selective targeting of specific receptor oligomers [21]. We also sought to

An overview of the synthetic routes to the best selling drugs containing 6-membered heterocycles

• Marcus Baumann and
• Ian R. Baxendale

Beilstein J. Org. Chem. 2013, 9, 2265–2319, doi:10.3762/bjoc.9.265

AgOTf-catalyzed one-pot reactions of 2-alkynylbenzaldoximes with α,β-unsaturated carbonyl compounds

• Qiuping Ding,
• Dan Wang,
• Puying Luo,
• Meiling Liu,
• Shouzhi Pu and
• Liyun Zhou

Beilstein J. Org. Chem. 2013, 9, 1949–1956, doi:10.3762/bjoc.9.231

• single operation, play an important role in atom-economical organic chemistry. A cascade reaction is the most efficient way for targeting fine chemicals, agrochemicals, pharmaceutical drugs, drug intermediates and ingredients by a one-pot reaction in environmentally and economically friendly synthetic

Synthesis and antibacterial activity of monocyclic 3-carboxamide tetramic acids

• Yong-Chul Jeong and
• Mark G. Moloney

Beilstein J. Org. Chem. 2013, 9, 1899–1906, doi:10.3762/bjoc.9.224

• exhibit a dual targeting ability at RNAP and UPPS, while 3-acyl piperidine-2,4-dione 1h only targets UPPS [10]. Although tetramates are well-known as a core component in many natural products that continue to excite interest [11][12][13][14], we carried out a more detailed study of the synthesis

Synthesis of mucin-type O-glycan probes as aminopropyl glycosides

• David Benito-Alifonso,
• Rachel A. Jones,
• Anh-Tuan Tran,
• Hannah Woodward,
• Nichola Smith and
• M. Carmen Galan

Beilstein J. Org. Chem. 2013, 9, 1867–1872, doi:10.3762/bjoc.9.218

• create a plethora of potential binding sites for commensal and pathogenic microbes, and are also ligands for the targeting of leucocytes to endothelial cells. Secreted mucins found in the intestinal mucus gel and the glycocalyx contain hundreds of different mucin type, O-linked oligosaccharides and

Bioinspired total synthesis of katsumadain A by organocatalytic enantioselective 1,4-conjugate addition

• Yongguang Wang,
• Ruiyang Bao,
• Shengdian Huang and
• Yefeng Tang

Beilstein J. Org. Chem. 2013, 9, 1601–1606, doi:10.3762/bjoc.9.182

• copper sulfate-induced emesis in young chicks. More recently, Rollinger et al. disclosed that katsumadain A (1) exhibited prominent in vitro inhibitory activity against the human influenza virus A/PR/8/34 of the subtype H1N1 (IC50 1.05–0.42 μM) by targeting the enzyme neuraminidase (NA) [4][5]. Moreover

Synthesis of the calcilytic ligand NPS 2143

• Henrik Johansson,
• Thomas Cailly,
• Alex Rojas Bie Thomsen,
• Hans Bräuner-Osborne and
• Daniel Sejer Pedersen

Beilstein J. Org. Chem. 2013, 9, 1383–1387, doi:10.3762/bjoc.9.154

• major classes (A, B and C) of which the rhodopsin-like class A is the largest and most diverse, and which has been well-studied and subject to drug targeting [3]. GPCR class C is much smaller and comprises only 22 known receptors including eight metabotropic glutamate (mGlu) receptors, two γ

The synthesis of well-defined poly(vinylbenzyl chloride)-grafted nanoparticles via RAFT polymerization

• John Moraes,
• Kohji Ohno,
• Guillaume Gody,
• Thomas Maschmeyer and
• Sébastien Perrier

Beilstein J. Org. Chem. 2013, 9, 1226–1234, doi:10.3762/bjoc.9.139

• conducted at 110 °C in the presence of the RAFT agent 2-(butylthiocarbonothioylthio)propionic acid (PABTC) without any additional initiator. In addition to targeting a high-molecular-weight polymer by choosing a high degree of polymerization (DP), we also prepared polymers of lower molecular weights (DP 100

• case proceeded at almost identical rates (although Figure 2B shows slight retardation at DP 100, as expected for RAFT polymerization targeting lower DPs, see above), irrespective of the DP, while similar linear semilog kinetics plots for each experiment suggest that the radical flux is constant over

• adversely affects the Mw/Mn values of the polymers at DP 4,100, which are consistently higher than those at DP 100 (compare experiments 6–10 with experiments 1–5 in Table 1). However, this is an unavoidable consequence of RAFT polymerization under these conditions, when targeting such extremely high DPs

Copper-catalyzed aerobic aliphatic C–H oxygenation with hydroperoxides

• Pei Chui Too,
• Ya Lin Tnay and
• Shunsuke Chiba

Beilstein J. Org. Chem. 2013, 9, 1217–1225, doi:10.3762/bjoc.9.138

• present aerobic strategy for the synthesis of 1,4-diols by targeting methylene C–H oxygenation with various tertiary hydroperoxides 1 (Table 2). Generally, oxygenation of benzylic methylene C–H bonds proceeded smoothly to give the corresponding 1,4-diols 3 in good to moderate yields (77–51% yields) (Table

Exploration of an epoxidation–ring-opening strategy for the synthesis of lyconadin A and discovery of an unexpected Payne rearrangement

• Brad M. Loertscher,
• Yu Zhang and
• Steven L. Castle

Beilstein J. Org. Chem. 2013, 9, 1179–1184, doi:10.3762/bjoc.9.132

• Brad M. Loertscher Yu Zhang Steven L. Castle Department of Chemistry and Biochemistry, Brigham Young University, C100 BNSN, Provo, UT, 84602, USA 10.3762/bjoc.9.132 Abstract In the context of synthetic efforts targeting the alkaloid lyconadin A, scalemic epoxide 25 was prepared by a highly

• location of the trityl ether in 26, they do provide compelling evidence that the carbon backbone of this compound is correct as drawn and is produced by a Payne rearrangement of some type. Conclusion In the context of synthetic efforts targeting the polycyclic alkaloid lyconadin A, we prepared scalemic

Synthesis and physicochemical characterization of novel phenotypic probes targeting the nuclear factor-kappa B signaling pathway

• Paul M. Hershberger,
• Satyamaheshwar Peddibhotla,
• E. Hampton Sessions,
• Daniela B. Divlianska,
• Ricardo G. Correa,
• Anthony B. Pinkerton,
• John C. Reed and
• Gregory P. Roth

Beilstein J. Org. Chem. 2013, 9, 900–907, doi:10.3762/bjoc.9.103