Elucidating the glycan-binding specificity and structure of Cucumis melo agglutinin, a new R-type lectin

• Jon Lundstrøm,
• Emilie Gillon,
• Valérie Chazalet,
• Nicole Kerekes,
• Antonio Di Maio,
• Ten Feizi,
• Yan Liu,
• Annabelle Varrot and
• Daniel Bojar

Beilstein J. Org. Chem. 2024, 20, 306–320, doi:10.3762/bjoc.20.31

• (ACACCTCGAGTTAGGGTTTGTACTGTGTCACGAACATCC). The primers contained the restriction sites (underlined) NcoI (sense) and XhoI (antisense) on their 5′-ends for further sub-cloning. PCR was performed using PrimeSTAR DNA polymerase. The purified PCR fragment of 395 bp was digested by NcoI and XhoI restriction enzymes, then ligated into pET40b

The role of chemistry in the success of oligonucleotides as therapeutics

• Pawan Kumar and
• Tom Brown

Beilstein J. Org. Chem. 2022, 18, 197–199, doi:10.3762/bjoc.18.22

• Pawan Kumar Tom Brown Takeda Development Center Americas, Inc. (TDCA), 9625 Town Centre Drive, San Diego, CA 92121, USA Chemistry Research Laboratory, University of Oxford, 12 Mansfield Road, Oxford, OX1 3TA, UK 10.3762/bjoc.18.22 Keywords: antisense oligonucleotides; chemically modified

• nucleotides; siRNAs; RNA-targeting oligonucleotides (e.g., antisense, siRNA, and anti-miR) are widely explored as fundamental research tools and are gaining increasing promise as therapeutic agents, particularly against diseases of genetic origin. The idea of treating a disease by targeting the molecular

• messenger (mRNA) to stop the synthesis of proteins using short strands of DNA, now known as antisense oligonucleotides, was first coined about 40 years ago [1]. Almost 20 years later, another endogenous mechanism, known as RNA interference (RNAi) was discovered when it was shown that short stretches of

Synthetic strategies toward 1,3-oxathiolane nucleoside analogues

• Umesh P. Aher,
• Dhananjai Srivastava,
• Girij P. Singh and
• Jayashree B. S

Beilstein J. Org. Chem. 2021, 17, 2680–2715, doi:10.3762/bjoc.17.182

Cationic oligonucleotide derivatives and conjugates: A favorable approach for enhanced DNA and RNA targeting oligonucleotides

• Mathias B. Danielsen and
• Jesper Wengel

Beilstein J. Org. Chem. 2021, 17, 1828–1848, doi:10.3762/bjoc.17.125

• Mathias B. Danielsen Jesper Wengel Biomolecular Nanoscale Engineering Center, Department of Physics, Chemistry and Pharmacy, University of Southern Denmark, Campusvej 55, 5230 Odense M, Denmark 10.3762/bjoc.17.125 Abstract Antisense oligonucleotides (ASOs) have the ability of binding to

• , and examining the future design for ASOs. Keywords: antisense oligonucleotides; backbone modifications; cations; nucleobase modifications; sugar modifications; Introduction Antisense oligonucleotides (ASOs) are single-stranded (ss) oligomers composed of typically 10–25 nucleotides linked by

• derivative group, when conjugated to the C-5 position on 2’-deoxyuridine (Table 1B, 12), improved antisense activity while reducing toxicity [39]. In addition, a 15-mer PS-ASO, modified with the C-5 tris-aminated 2’-deoxyuridine 12, improved anti-HIV activity and reduced cytotoxicity relative to the

Chemical approaches to discover the full potential of peptide nucleic acids in biomedical applications

• Nikita Brodyagin,
• Martins Katkevics,
• Venubabu Kotikam,
• Christopher A. Ryan and
• Eriks Rozners

Beilstein J. Org. Chem. 2021, 17, 1641–1688, doi:10.3762/bjoc.17.116

• for innovative chemistry and biology to unlock the full potential of PNA in biomedical applications. Keywords: antisense; chemical modifications; diagnostics; peptide nucleic acid; PNA; Introduction Peptide nucleic acid (PNA) is a DNA mimic where the sugar–phosphate backbone of DNA is replaced with

• discoveries that revealed the remarkable nucleic acid binding properties of PNA boosted enthusiasm about PNA’s potential as an antisense and antigene therapeutic agent [38]. Structures of PNA complexes Early NMR structural studies suggested that PNA formed heteroduplexes with DNA [39] and RNA [40] that

• cells [72]. GPNA targeting the transcriptional start-site of the human E-cadherin gene had potent and sequence-specific antisense activity and was less toxic to the cells than the PNA–polyarginine conjugate [73]. Interestingly, the α-arginine modification in either ʟ- or ᴅ-configuration destabilized PNA

Double-headed nucleosides: Synthesis and applications

• Vineet Verma,
• Jyotirmoy Maity,
• Vipin K. Maikhuri,
• Ritika Sharma,
• Himal K. Ganguly and
• Ashok K. Prasad

Beilstein J. Org. Chem. 2021, 17, 1392–1439, doi:10.3762/bjoc.17.98

• simulations [15][22]. The double-headed nucleoside 157a was further used for the synthesis of 5-(phenyltriazol)-2′-deoxyuridine-modified 2′-O-methyl mixmer antisense oligonucleotides (AOs). The obtained AOs were investigated for their potential to induce exon skipping in DMD (Duchenne muscular dystrophy

Antiviral therapy in shrimp through plant virus VLP containing VP28 dsRNA against WSSV

• Santiago Ramos-Carreño,
• Ivone Giffard-Mena,
• Jose N. Zamudio-Ocadiz,
• Alfredo Nuñez-Rivera,
• Ricardo Valencia-Yañez,
• Jaime Ruiz-Garcia,
• Maria Teresa Viana and
• Ruben D. Cadena-Nava

Beilstein J. Org. Chem. 2021, 17, 1360–1373, doi:10.3762/bjoc.17.95

• , damaging the VLPs. Therefore, further studies should be on how this can be administered in the pellets at industrial levels. Other studies by IM injection of chemically modified chitosan nanoparticles loaded with anti-VP28 RNA [20] and antisense plasmid constructs for VP28 [24] have shown protection of 95

Beyond ribose and phosphate: Selected nucleic acid modifications for structure–function investigations and therapeutic applications

• Christopher Liczner,
• Kieran Duke,
• Gabrielle Juneau,
• Martin Egli and
• Christopher J. Wilds

Beilstein J. Org. Chem. 2021, 17, 908–931, doi:10.3762/bjoc.17.76

• oligonucleotides that have been explored for gene silencing. Keywords: antisense; chemically modified oligonucleotides; crystallography; siRNA; structure; Introduction The natural nucleic acids sugar-phosphate backbone comes in two flavors, 2'-deoxyribose in DNA and ribose in RNA. However, this relative

• DNA G:C > A:T whereas in homo-DNA (2',3'-β-ᴅ-dideoxyglucopyranose nucleic acid) G:C > A:A ≈ G:G > A:T (reverse Hoogsteen A:A and G:G pairs) ([40] and cited references). Messenger RNA is the target of both the antisense and RNAi strategies to interfere with biological information transfer prior to

• attributes, nuclease stability, and hybridization to single and double stranded nucleic acid targets have led to studies to investigate 3'-NP DNA for antisense and antigene purposes. For example, as an antisense agent in the treatment of human leukemia [67], as an inhibitor of transcription elongation

DNA with zwitterionic and negatively charged phosphate modifications: Formation of DNA triplexes, duplexes and cell uptake studies

• Yongdong Su,
• Maitsetseg Bayarjargal,
• Tracy K. Hale and
• Vyacheslav V. Filichev

Beilstein J. Org. Chem. 2021, 17, 749–761, doi:10.3762/bjoc.17.65

• parallel triple-helix structure, a polypyrimidine TFO binds to dsDNA through Hoogsteen base-pairing [17], in which the cytosine bases in the TFO are protonated at the N3 atom (Figure 1B). In antisense strategies, antisense ONs (AOs) interact with RNA molecules to interfere with protein expression [18][19

• ]. The major challenge in designing chemically modified ONs as antigene/antisense agents is to ensure an efficient cellular uptake and nuclease resistance while still maintaining, or ideally increasing, binding affinity and specificity of the ONs towards their DNA or RNA target. Many synthetic analogues

• of natural ONs, such as peptide nucleic acids (PNA) [20], locked nucleic acids [21] (LNA, also known as bridged nucleic acids (BNA) [22]) and phosphorothioate (PS) ONs [23][24] have been evaluated for antigene/antisense applications, however, each of the analogues did not meet all the requirements

Synthesis and properties of oligonucleotides modified with an N-methylguanidine-bridged nucleic acid (GuNA[Me]) bearing adenine, guanine, or 5-methylcytosine nucleobases

• Naohiro Horie,
• Takao Yamaguchi,
• Shinji Kumagai and
• Satoshi Obika

Beilstein J. Org. Chem. 2021, 17, 622–629, doi:10.3762/bjoc.17.54

• the stability against nucleases, binding affinity to the targets, and efficacy. We previously reported that oligonucleotides modified with an N-methylguanidine-bridged nucleic acid (GuNA[Me]) bearing the thymine (T) nucleobase show excellent biophysical properties for applications in antisense

• data indicate that GuNA[Me] could be a useful modification for therapeutic antisense oligonucleotides. Keywords: artificial nucleic acid; duplex-forming ability; oligonucleotide synthesis; Introduction The efficacy and safety of therapeutic oligonucleotides can be controlled by chemical modifications

• . For applications in antisense technology, chemical modifications aimed at enhancing the duplex-forming ability toward a target RNA (i.e., a complementary single-stranded RNA) and improving the stability against enzymatic degradations are commonly utilized. For instance, antisense oligonucleotides

In search of visible-light photoresponsive peptide nucleic acids (PNAs) for reversible control of DNA hybridization

• Lei Zhang,
• Greta Linden and
• Olalla Vázquez

Beilstein J. Org. Chem. 2019, 15, 2500–2508, doi:10.3762/bjoc.15.243

• ] and in vivo [8][9][10][11][12]. Manipulation of gene expression demonstrated therapeutic application – antisense chemistry [13]. Along these lines, photopharmacology [14][15] is an emerging field that highlights the importance of reversible photocontrollable drugs in tomorrow’s medicine, but

• photoswitchable antisense research in the context of photopharmacology is entirely unexplored. Furthermore, reversible approaches with photoswitches will contribute to a better understanding of biological pathways as they would allow precise reversible spatio-temporal activation/deactivation of the desired

• , having at our disposal such antisense probes, whose activation is reversibly controlled, will contribute to the deciphering of biological pathways. Furthermore, the exceptional stability of the cis-isomer may open new venues of this artificial photoswitchable oligonucleotide in other fields different

Electrophilic oligodeoxynucleotide synthesis using dM-Dmoc for amino protection

• Shahien Shahsavari,
• Dhananjani N. A. M. Eriyagama,
• Bhaskar Halami,
• Vagarshak Begoyan,
• Marina Tanasova,
• Jinsen Chen and
• Shiyue Fang

Beilstein J. Org. Chem. 2019, 15, 1116–1128, doi:10.3762/bjoc.15.108

• instability of the adduct under acidic conditions during ODN synthesis [7]. In recent years, applications of ODNs have extended to emerging areas such as nanotechnology [8][9], antisense drug development [10][11][12], DNA damage and repair [13][14], DNA methylation and demethylation [15][16][17][18], DNA

Synthesis, biophysical properties, and RNase H activity of 6’-difluoro[4.3.0]bicyclo-DNA

• Sibylle Frei,
• Adam K. Katolik and
• Christian J. Leumann

Beilstein J. Org. Chem. 2019, 15, 79–88, doi:10.3762/bjoc.15.9

• ; Introduction The fluorine atom is a very attractive substituent in medicinal chemistry due to the beneficial biological effects induced by this atom on the overall drug behaviour [1][2][3][4][5]. The positive influences on the drug behaviour is not limited to small molecules but is also valid for antisense

• oligonucleotides (AONs) [6]. An effective way to tune the properties of antisense oligonucleotides is by the insertion of the fluorine atom in the sugar moiety of the nucleoside. In this way, the sugar pucker can be controlled which ideally results in an increased affinity towards complementary RNA [7]. An

• cleavage of the RNA strand of an AON/RNA hybrid structure by the endonuclease RNase H [9][18]. Both, the F–ANA and the F–RNA, are appealing modifications for several oligonucleotide-based silencing applications [8][19][20][21][22][23][24][25]. Also evaluated on their antisense properties were the 3

6’-Fluoro[4.3.0]bicyclo nucleic acid: synthesis, biophysical properties and molecular dynamics simulations

• Sibylle Frei,
• Andrei Istrate and
• Christian J. Leumann

Beilstein J. Org. Chem. 2018, 14, 3088–3097, doi:10.3762/bjoc.14.288

• use of therapeutic antisense oligonucleotides (AONs) [1][2][3][4]. These short, synthetic fragments bind through Watson–Crick base pairing to cellular RNA, thus modulating or silencing the gene expression through various mechanisms [5][6][7]. One mode of action is the recruitment of the endonuclease

• ’-deoxy-2’-fluoroarabino nucleic acid (F-ANA) [32][33][34], 3’-hexitol nucleic acids (FHNA and Ara-FHNA) [35], 2’-fluorocyclohexenyl nucleic acid (F-CeNA) [36], and other modifications [37][38][39][40][41] were evaluated for their antisense properties. In this context, our research group has

Synthesis and photophysical studies of a multivalent photoreactive Ru^II-calix[4]arene complex bearing RGD-containing cyclopentapeptides

• Sofia Kajouj,
• Lionel Marcelis,
• Alice Mattiuzzi,
• Adrien Grassin,
• Damien Dufour,
• Pierre Van Antwerpen,
• Didier Boturyn,
• Eric Defrancq,
• Mathieu Surin,
• Julien De Winter,
• Pascal Gerbaux,
• Ivan Jabin and
• Cécile Moucheron

Beilstein J. Org. Chem. 2018, 14, 1758–1768, doi:10.3762/bjoc.14.150

• activity of enzymes such as RNA polymerase or endonuclease is inhibited in vitro at the level of the photoadduct [23][24]. In order to target a specific DNA sequence, photoreactive RuII complexes have been anchored to specific antisense oligonucleotides to inhibit the expression of the complementary

Oligonucleotide analogues with cationic backbone linkages

• Melissa Meng and
• Christian Ducho

Beilstein J. Org. Chem. 2018, 14, 1293–1308, doi:10.3762/bjoc.14.111

• and binds to double-stranded DNA to form a triple helix. The triple helix is not a substrate for the transcription machinery, and hence, RNA biosynthesis (and therefore protein formation) is blocked. In the antisense pathway [3], the ON binds to single-stranded mRNA in the cytoplasm, thus furnishing a

• competition of the cationic antigene oligonucleotide with cellular histones for DNA binding [43]. Vasseur, Debart and co-workers have combined a variant of Letsinger's linkages with an α-configuration at the anomeric centers of antisense oligonucleotides [44][45]. They have found that such zwitterionic to

• significantly reduced in the presence of a base mismatch. This specificity in binding suggested that such oligonucleotides should be promising sterically blocking antisense agents as their RNA targets were not digested by RNAse H. This anticipated bioactivity was confirmed in whole cell assays without the

Stimuli-responsive oligonucleotides in prodrug-based approaches for gene silencing

• Françoise Debart,
• Christelle Dupouy and
• Jean-Jacques Vasseur

Beilstein J. Org. Chem. 2018, 14, 436–469, doi:10.3762/bjoc.14.32

• strategies include antisense oligonucleotides (AONs), ribozymes, DNAzymes, small interfering RNAs (siRNAs) and micro RNAs (miRNAs) that specifically target the complementary mRNA sequence of the relevant undesired gene before translation. AONs are single-stranded DNA of 15 to 25 nucleotides in length that

• guided by miRNAs (22 nucleotides in length) that bind incorrectly within the 3’-untranslated region (3’-UTR) of the target mRNAs [7]. miRNAs also represent interesting targets, and inhibition of their function was obtained using anti-miRNA AONs via an antisense approach or via the blocking of the mRNA

• ’-OH siRNAs was similarly demonstrated in the presence of 10 mM GSH. Furthermore, firefly luciferase expression in A549-Luc cells was inhibited by 2’-O-MDTM siRNAs to a higher extent than the unmodified siRNA regardless of the modification site (5’-end and/or the seed region of the antisense strand

Fluorescent nucleobase analogues for base–base FRET in nucleic acids: synthesis, photophysics and applications

• Mattias Bood,
• Sangamesh Sarangamath,
• Moa S. Wranne,
• Morten Grøtli and
• L. Marcus Wilhelmsson

Beilstein J. Org. Chem. 2018, 14, 114–129, doi:10.3762/bjoc.14.7

• the hydroxy group. The formed complex eliminates water and yielded the cyclization product in 75% after isolation. In an effort to increase the thermodynamic stability of oligonucleotide duplexes for antisense purposes, Lin et al. turned to size-expanded nucleobase analogues [41]. To this end they

Synthesis of oligonucleotides on a soluble support

• Harri Lönnberg

Beilstein J. Org. Chem. 2017, 13, 1368–1387, doi:10.3762/bjoc.13.134

• applied to the synthesis of a PEG-conjugated 12-mer antisense ODN [53] and a 13-mer purine-rich triple-helix forming sequence [54]. Immobilization of the 3´-terminal nucleosides via a succinyl linker was, however, replaced by direct phosphoramidite coupling to the terminal OH of PEG, which gave a stable

A postsynthetically 2’-“clickable” uridine with arabino configuration and its application for fluorescent labeling and imaging of DNA

• Heidi-Kristin Walter,
• Bettina Olshausen,
• Ute Schepers and
• Hans-Achim Wagenknecht

Beilstein J. Org. Chem. 2017, 13, 127–137, doi:10.3762/bjoc.13.16

• structure of double-helical DNA elucidates that the positioning of the fluorophores in the major groove may be improved by inversion of the configuration at the 2’-position of the anchor nucleoside sugar. In fact, arabino nucleic acids are an important class of antisense oligonucleotides [20] since their

Preparation of a disulfide-linked precipitative soluble support for solution-phase synthesis of trimeric oligodeoxyribonucleotide 3´-(2-chlorophenylphosphate) building blocks

• Amit M. Jabgunde,
• Alejandro Gimenez Molina,
• Pasi Virta and
• Harri Lönnberg

Beilstein J. Org. Chem. 2015, 11, 1553–1560, doi:10.3762/bjoc.11.171

• acids have been used to regulate gene expression through different mechanisms of action, such as antisense oligonucleotides [1][2], ribozymes [3], interfering RNAs (siRNA) [4][5] and immunostimulatory CpG [6] based therapeutics. At the same time, the interest in detailed understanding of the factors

Multivalent dendritic polyglycerolamine with arginine and histidine end groups for efficient siRNA transfection

• Fatemeh Sheikhi Mehrabadi,
• Hanxiang Zeng,
• Mark Johnson,
• Cathleen Schlesener,
• Zhibin Guan and
• Rainer Haag

Beilstein J. Org. Chem. 2015, 11, 763–772, doi:10.3762/bjoc.11.86

• , respectively. Unmodified Silencer® series siRNA was used for GFP silencing experiments with the following sequence: sense 5’-CAAGCUGACCCUGAAGUUCTT-3’ and antisense 5’-GAACUUCAGGGUCAGCUUGCC-3’. All water used in the biological experiments was nanopure water obtained from Barnstead Nanopure Diamond (Waltham, MA

Sequence-specific RNA cleavage by PNA conjugates of the metal-free artificial ribonuclease tris(2-aminobenzimidazole)

• Friederike Danneberg,
• Alice Ghidini,
• Plamena Dogandzhiyski,
• Elisabeth Kalden,
• Roger Strömberg and
• Michael W. Göbel

Beilstein J. Org. Chem. 2015, 11, 493–498, doi:10.3762/bjoc.11.55

• and Nutrition, Novum, SE-141 83 Huddinge, Sweden 10.3762/bjoc.11.55 Abstract Tris(2-aminobenzimidazole) conjugates with antisense oligonucleotides are effective site-specific RNA cleavers. Their mechanism of action is independent of metal ions. Here we investigate conjugates with peptide nucleic

• required an HgO induced cyclization step, a mercury free variant is described herein. Keywords: antisense; fluorescence correlation spectroscopy; guanidine; miRNA 20a; peptide nucleic acids; Introduction Sequence specific artificial ribonucleases are an attractive research target for several reasons. On

Synthesis of dinucleoside acylphosphonites by phosphonodiamidite chemistry and investigation of phosphorus epimerization

• William H. Hersh

Beilstein J. Org. Chem. 2015, 11, 184–191, doi:10.3762/bjoc.11.19

• barrier was found to be high as no epimerization was detected up to 150 °C, and consistent with this, density functional theory calculations give an inversion barrier of over 40 kcal/mol. Keywords: acylphosphine; acyl phosphite; chiral; DFT; NMR; nucleic acids; oligonucleotides; Introduction Antisense

• to mRNA, and recruitment of RNase H. A selection of recent publications [3][4][5][6][7] illustrates the changes that have occurred since the first antisense drug was approved in 1998 [8]. However, despite ongoing clinical trials, only recently has a second antisense drug [3] been approved [9]. Most

• (albeit not all) antisense reagents, including the two approved drugs, are phosphorothioates, in which one of the terminal oxygen atoms on the phosphodiester internucleotide linker is replaced by sulfur. A potential issue with phosphorothioates is the creation of a new stereocenter at every phosphorus

NAA-modified DNA oligonucleotides with zwitterionic backbones: stereoselective synthesis of A–T phosphoramidite building blocks

• Boris Schmidtgall,
• Claudia Höbartner and
• Christian Ducho

Beilstein J. Org. Chem. 2015, 11, 50–60, doi:10.3762/bjoc.11.8

• Oligonucleotides are important agents for a number of biomedical applications [1]. Thus, they are employed to exert antigene [2] or antisense [3] mechanisms as well as to trigger or inhibit RNA interference [4]. The capability of sequence-specific molecular recognition is a striking feature of nucleic acids, but