Synthesis and in vitro cytotoxicity of acetylated 3-fluoro, 4-fluoro and 3,4-difluoro analogs of D-glucosamine and D-galactosamine

• Štěpán Horník,
• Lucie Červenková Šťastná,
• Petra Cuřínová,
• Jan Sýkora,
• Kateřina Káňová,
• Roman Hrstka,
• Ivana Císařová,
• Martin Dračínský and
• Jindřich Karban

Beilstein J. Org. Chem. 2016, 12, 750–759, doi:10.3762/bjoc.12.75

• for a variety of acylated (nonfluorinated) D-mannosamine and D-glucosamine derivatives [62][63]. Acylated hexosamine derivatives were subsequently studied as possible templates for the development of anticancer therapeutics [64][65]. While the ability of hexosamine derivatives and analogs to inhibit

From steroids to aqueous supramolecular chemistry: an autobiographical career review

• Bruce C. Gibb

Beilstein J. Org. Chem. 2016, 12, 684–701, doi:10.3762/bjoc.12.69

• to be useful hosts, these deep-cavity cavitands also demonstrated that resorcinarenes could be used as covalent templates to form macrocycles. For example, the deep-cavity cavitand shown in Scheme 8 can be treated with excess BBr3 to cleave the four, benzal-bridges and liberate a new family of

Creating molecular macrocycles for anion recognition

• Amar H. Flood

Beilstein J. Org. Chem. 2016, 12, 611–627, doi:10.3762/bjoc.12.60

• cyanostar macrocycles is still being explored. The large binding pockets and the C5 symmetry provide a basis for a lot of new chemistry. This includes use of phosphodiesters as templates for the synthesis of [3]rotaxanes [7] (Figure 13). The other aspect of these macrocycles arising from their π surface is

My maize and blue brick road to physical organic chemistry in materials

• Anne J. McNeil

Beilstein J. Org. Chem. 2016, 12, 229–238, doi:10.3762/bjoc.12.24

• templates for synthesizing materials with high surface areas. The future of molecular gels remains bright. Two areas of growing importance include: (i) applying advanced solid-state characterization methods to gain insight into the molecular packing within gel fibers, and (ii) efforts towards correlating

Assembly of synthetic Aβ miniamyloids on polyol templates

• Sebastian Nils Fischer and
• Armin Geyer

Beilstein J. Org. Chem. 2015, 11, 2646–2653, doi:10.3762/bjoc.11.284

• , Aβ peptide pentapeptide boronic acids 1 and 2 were synthesized by solid-phase peptide synthesis and studied in esterification experiments with polyhydroxylated templates. The bis-hydroxylated dipeptide Hot=Tap serves as a template of adjustable degree of oligomerization which spontaneously forms

• molecular weights in the region of several kilodalton. Sugars (polyols) were already investigated as templates for peptides [6] and vice versa [7] but both concepts were not yet used for the assembly of monodisperse Aβ miniamyloids. Lehn’s concept of constitutional dynamic chemistry (CDC) [8][9] relies on

• avoided only when two different reactive groups are employed; that is why the reversible esterification between boronic acids and diols appeared an attractive solution to us. In a first approach, we planned to condense short peptide boronic acids with polyol templates for the assembly of an Aβ-dimer. The

Aggregation behaviour of amphiphilic cyclodextrins: the nucleation stage by atomistic molecular dynamics simulations

• Giuseppina Raffaini,
• Antonino Mazzaglia and
• Fabio Ganazzoli

Beilstein J. Org. Chem. 2015, 11, 2459–2473, doi:10.3762/bjoc.11.267

• summarizes the main results with an outlook to future work. Simulation Method The simulations were performed with InsightII/Discover 2000 [44], using the consistent valence force field CVFF [45] as previously done [35][39][40][46]. The geometry of the model aCD, generated with the available templates of

Preparation of Pickering emulsions through interfacial adsorption by soft cyclodextrin nanogels

• Shintaro Kawano,
• Toshiyuki Kida,
• Mitsuru Akashi,
• Hirofumi Sato,
• Motohiro Shizuma and
• Daisuke Ono

Beilstein J. Org. Chem. 2015, 11, 2355–2364, doi:10.3762/bjoc.11.257

• crosslinked polymers, have recently been demonstrated as Pickering emulsifiers with pH or thermo-responsive properties [7][8][9]. Such emulsions have potential in pharmaceutical, food, and cosmetic products. Moreover, emulsions stabilized by stimuli-responsive soft microgels should be applicable as templates

Synthesis of photoresponsive cholesterol-based azobenzene organogels: dependence on different spacer lengths

• Yuchun Ren,
• Bin Wang and
• Xiuqing Zhang

Beilstein J. Org. Chem. 2015, 11, 1089–1095, doi:10.3762/bjoc.11.122

• ; organogel; photoresponsive; Introduction In the past few decades, low molecular mass organic gelators (LMOGs) have attracted increasing attention not only for basic self-assembly behavior but also for their potential application in areas such as templates [1], light harvesting [2], fluorescent scensing [3

Orthogonal dual-modification of proteins for the engineering of multivalent protein scaffolds

• Michaela Mühlberg,
• Michael G. Hoesl,
• Christian Kuehne,
• Jens Dernedde,
• Nediljko Budisa and
• Christian P. R. Hackenberger

Beilstein J. Org. Chem. 2015, 11, 784–791, doi:10.3762/bjoc.11.88

• use of chemical labeling methods to study structure and function of proteins in vitro and in vivo, chemoselective conjugation techniques are also used to functionalize artificial protein scaffolds, such as viral capsids [5][6][7]. Such templates have self-assembled hierarchical structures that allow

DNA display of glycoconjugates to emulate oligomeric interactions of glycans

• Alexandre Novoa and
• Nicolas Winssinger

Beilstein J. Org. Chem. 2015, 11, 707–719, doi:10.3762/bjoc.11.81

• different chemistries used in the glycoconjugations and the different strategies used to display the glycans with DNA templates. Review Glycan–DNA conjugates An initial solution used in the pioneering work of Kobayashi [17] for nucleic acid–glycan conjugation was the chemoselective reaction of p

• in the glycans. DC-SIGN is a tetrameric lectin implicated in interactions with a broad array of pathogens including HIV. A library of 37,485 assemblies was prepared by hybridization of two sets of PNA-tagged glycoconjugates onto a library of DNA templates (Figure 4). Screening the library by affinity

• set of five different glycan–PNA conjugates and different DNA templates, the optimal spatial arrangement of the ligands was systematically investigated. Additionally, the flexibility of the PNA–DNA duplexes was also modulated by introducing nick-sites and partially unpaired regions in the DNA display

IR and electrochemical synthesis and characterization of thin films of PEDOT grown on platinum single crystal electrodes in [EMMIM]Tf₂N ionic liquid

• Andrea P. Sandoval,
• Marco F. Suárez-Herrera and
• Juan M. Feliu

Beilstein J. Org. Chem. 2015, 11, 348–357, doi:10.3762/bjoc.11.40

• ) < Pt(110) < Pt(111) [6]. The synthesis of other conducting polymers on well-defined surfaces [7][8][9][10] and templates [11] also has shown how the surface affects their adhesion, coverage, morphology and redox kinetics. On the other hand, the synthesis of conducting polymers in ionic liquids (ILs

Morita–Baylis–Hillman reaction of acrylamide with isatin derivatives

• Radhey M. Singh,
• Kishor Chandra Bharadwaj and
• Dharmendra Kumar Tiwari

Beilstein J. Org. Chem. 2014, 10, 2975–2980, doi:10.3762/bjoc.10.315

• . This is especially relevant given the fact that they have been extensively used in drug design [23][24], polymer chemistry [25][26] and are popular synthetic templates [27][28]. For further comparison to other acryl systems, acrylamide also offers extra valencies at nitrogen, which can be used for

A new charge-tagged proline-based organocatalyst for mechanistic studies using electrospray mass spectrometry

• J. Alexander Willms,
• Rita Beel,
• Martin L. Schmidt,
• Christian Mundt and
• Marianne Engeser

Beilstein J. Org. Chem. 2014, 10, 2027–2037, doi:10.3762/bjoc.10.211

• proline catalyst 1. Proposed catalytic cycle [36][37][38] for the aldol reaction with aldehyde donors [54]; CT = charge tag, a: R = Ph, b: R = Et. Acknowledgements Financial support from the DFG (SFB 624 “templates”) is gratefully acknowledged. We thank Charlotte Rödde and Dr. Gregor Schnakenburg for the

Theoretical study of the adsorption of benzene on coinage metals

• Werner Reckien,
• Melanie Eggers and
• Thomas Bredow

Beilstein J. Org. Chem. 2014, 10, 1775–1784, doi:10.3762/bjoc.10.185

• surfaces. Acknowledgements Financial support by DFG in the framework of the collaborative research center SFB 624 “Templates” at the University of Bonn is gratefully acknowledged.

Chemical templates

• Sigurd Höger

Beilstein J. Org. Chem. 2014, 10, 1670–1671, doi:10.3762/bjoc.10.174

• in a stoichiometric or a catalytic way, it can be reused or remain in the product as an integral part. Template effects in chemistry are commonly associated with the formation of (macro)cycles, or covalent bond formation in general. However, chemical templates can also exert a variety of other

• planar substrate with a specific structure and composition, determines the respective pattern formation on its surface. And three-dimensional templates are a unique and versatile tool for providing well-designed volume structures, often decorated with useful functionality. Not surprisingly, the annual

Substitution effect and effect of axle’s flexibility at (pseudo-)rotaxanes

• Friedrich Malberg,
• Jan Gerit Brandenburg,
• Werner Reckien,
• Oldamur Hollóczki,
• Stefan Grimme and
• Barbara Kirchner

Beilstein J. Org. Chem. 2014, 10, 1299–1307, doi:10.3762/bjoc.10.131

• differences such as substitution or dealkylation. Acknowledgements We would like to thank the DFG in the framework of the collaborative research center SFB 624 “Templates” at the University of Bonn for the funding of this research. Furthermore, the financial support of the DFG project KI 768/7-1 is gratefully

Molecular architecture with carbohydrate functionalized β-peptides adopting 3₁₄-helical conformation

• Nitin J. Pawar,
• Navdeep S. Sidhu,
• George M. Sheldrick,
• Dilip D. Dhavale and
• Ulf Diederichsen

Beilstein J. Org. Chem. 2014, 10, 948–955, doi:10.3762/bjoc.10.93

• cooperative effects. To evaluate carbohydrate interaction and recognition, the structurally defined attachment of sugar units to a rigid template is highly desired. β-Peptide helices offer conformationally stable templates for the linear presentation of sugar units in defined distances. The synthesis and β

• , galactose and xylose derivatives were incorporated as sugar units in rigid peptide templates. Keeping the proper β3-configuration for getting a β-peptide 314-helix (2–6) the isopropylidene protecting group and an anomeric acetal are structurally well tolerated. An additional perspective emerged from the

The influence of intraannular templates on the liquid crystallinity of shape-persistent macrocycles

• Joscha Vollmeyer,
• Ute Baumeister and
• Sigurd Höger

Beilstein J. Org. Chem. 2014, 10, 910–920, doi:10.3762/bjoc.10.89

• intraannular bridges serve in this case as templates that reduce the oligomerization even when the reaction is not performed under pseudo high-dilution conditions. The extraannular as well as the intraannular substituents have a strong influence on the thermal behavior of the compounds. With branched alkyl

• planar. Keywords: discotic liquid crystals; shape-persistent macrocycles; templates; X-ray scattering; Introduction The supramolecular chemistry of shape-persistent macrocycles has enormously expanded during the past several years [1][2][3][4][5][6]. It covers the non-covalent interaction between the

• non-covalently or covalently bound to the bisacetylenes [45][49][50]. The template does not necessarily only support the desired cyclization, it can also take over an active function in the final target structure. Covalently attached templates have the advantage over most of the supramolecular

Molecular recognition of isomeric protonated amino acid esters monitored by ESI-mass spectrometry

• Andrea Liesenfeld and
• Arne Lützen

Beilstein J. Org. Chem. 2014, 10, 825–831, doi:10.3762/bjoc.10.78

• two new templates based on a 9,9’-spirobifluorene core and tested them with regard to their ability to recognize the three isomeric amino acids in form of their protonated methyl esters. We decided to use ESI-mass spectrometry for these tests since this technique is fast to perform, consumes only

• trace amounts of material, and can be used to explore competitive experiments that are difficult to perform using UV–vis or NMR spectroscopy. Results and Discussion Design and synthesis of the concave templates Ammonium ions exhibit strong binding affinity towards crown ether moieties. Hence, we decided

• non-polar parts of the substrates, e.g., via attractive dispersive interactions, or provide steric hindrance that prevents substrates of a certain shape to be accommodated in the concave binding site of the templates. Since the 9,9’-spirobifluorene moiety provides such a rigid concave, non-polar

Self-assembly of metallosupramolecular rhombi from chiral concave 9,9’-spirobifluorene-derived bis(pyridine) ligands

• Rainer Hovorka,
• Sophie Hytteballe,
• Torsten Piehler,
• Georg Meyer-Eppler,
• Filip Topić,
• Kari Rissanen,
• Marianne Engeser and
• Arne Lützen

Beilstein J. Org. Chem. 2014, 10, 432–441, doi:10.3762/bjoc.10.40

• , University of Jyväskylä, P.O. Box 35, 40014 Jyväskylä, Finland 10.3762/bjoc.10.40 Abstract Two new 9,9’-spirobifluorene-based bis(4-pyridines) were synthesised in enantiopure and one also in racemic form. These ligands act as concave templates and form metallosupramolecular [(dppp)2M2L2] rhombi with cis

• . Keywords: concave templates; metal complexes; self-assembly; self-sorting; 9,9’-spirobifluorene; supramolecular chemistry; Introduction Concave templates are versatile tools to achieve self-sorting behaviour in the self-assembly of defined aggregates from multicomponent mixtures in a social self

• far we have studied templates based on the Tröger’s base [27] and the 2,2’-dihydroxybinaphthyl (BINOL) [28] scaffold and identified the bend angle of these V-shaped compounds to be a critical factor for the degree of self-sorting that can be achieved [9][15][16][17][18][25][26][27][28]. The 9,9

Intermediates in monensin biosynthesis: A late step in biosynthesis of the polyether ionophore monensin is crucial for the integrity of cation binding

• Wolfgang Hüttel,
• Jonathan B. Spencer and
• Peter F. Leadlay

Beilstein J. Org. Chem. 2014, 10, 361–368, doi:10.3762/bjoc.10.34

• : CGCGAATTCTCATGTTTGACCGCTTA TCATCGATAAGCTTTCCCGCCAGCCTCGCAGAG; SCAT2rev: CACCGGAAGGAGCTGACTGGGTTGAAGGCTC TCAAGGGCGAAGTTCCTATACTTTCTA. The cosmids Cos2 (monE) and Cos11 (monD) from a cosmid library of S. cinnamonensis [16] were used as templates for PCR. All mutants were verified by sequencing on both forward and reverse

Tuning the interactions between electron spins in fullerene-based triad systems

• Maria A. Lebedeva,
• Thomas W. Chamberlain,
• E. Stephen Davies,
• Bradley E. Thomas,
• Martin Schröder and
• Andrei N. Khlobystov

Beilstein J. Org. Chem. 2014, 10, 332–343, doi:10.3762/bjoc.10.31

• and 2D ordering is a critical factor in the design of molecular electronics. For example, linear molecules can be ordered readily into 1D arrays using carbon nanotubes as templates [18] and are therefore advantageous compared to non-linear or branched molecules for which 1D packing arrangements are

Novel supramolecular affinity materials based on (−)-isosteviol as molecular templates

• Christina Lohoelter,
• Malte Brutschy,
• Daniel Lubczyk and
• Siegfried R. Waldvogel

Beilstein J. Org. Chem. 2013, 9, 2821–2833, doi:10.3762/bjoc.9.317

• particular as templates for tracing air-borne arenes at low concentration. The affinities of the synthesized materials towards different air-borne arenes were determined by 200 MHz quartz crystal microbalances. Keywords: affinity materials; (−)-Isosteviol; supramolecular chemistry; triphenylene ketals

• ; triptycenes; templates; Introduction Divalent building blocks with a well-defined geometry play a significant role in the construction of highly potent supramolecular structures [1][2][3][4][5]. The rigid nature of such architectures limits the degrees of freedom and guarantees a good preorganization [1][2

• ][6][7][8][9][10]. Particular interest was given to C3-symmetric structures, serving e.g. as templates in asymmetric catalysis or molecular recognition [11][12][13][14]. A specific but potent subclass of such C3-symmetric architectures is represented by triphenylene ketals [15]. They have found

Topochemical control of the photodimerization of aromatic compounds by γ-cyclodextrin thioethers in aqueous solution

• Hai Ming Wang and
• Gerhard Wenz

Beilstein J. Org. Chem. 2013, 9, 1858–1866, doi:10.3762/bjoc.9.217

• transformations in homogeneous media, and various mixtures of products are obtained. Pre-organization of the reactants in the solid state [3] or by various templates in solution has been the best solution to this problem [4][5]. Cyclic host molecules large enough to accommodate two reacting molecules are the

• smallest possible templates for the control of photoreactions. Such a host provides a well-defined nano environment, a so-called molecular reaction vessel [6], which can catalyze and direct particular transformations. Calixarenes [7], cucurbiturils [8][9], and cyclodextrins (CDs) [10][11][12][13][14][15

A³-Coupling catalyzed by robust Au nanoparticles covalently bonded to HS-functionalized cellulose nanocrystalline films

• Jian-Lin Huang,
• Derek G. Gray and
• Chao-Jun Li

Beilstein J. Org. Chem. 2013, 9, 1388–1396, doi:10.3762/bjoc.9.155

• for CNCs include nanocomposite formulation, polymer reinforcement, drug delivery [27], enzyme immobilization [28], biomedical applications [29] and as templates for the synthesis of nanomaterials [30]. The deposition of metal nanoparticles onto the surface of CNCs can lead to new nano-heterogeneous