Repurposing the anticancer drug cisplatin with the aim of developing novel Pseudomonas aeruginosa infection control agents

• Mingjun Yuan,
• Song Lin Chua,
• Yang Liu,
• Daniela I. Drautz-Moses,
• Joey Kuok Hoong Yam,
• Thet Tun Aung,
• Roger W. Beuerman,
• May Margarette Santillan Salido,
• Stephan C. Schuster,
• Choon-Hong Tan,
• Michael Givskov,
• Liang Yang and
• Thomas E. Nielsen

Beilstein J. Org. Chem. 2018, 14, 3059–3069, doi:10.3762/bjoc.14.284

• conducted for two biological replicates of each sample. The rRNA-depleted RNA was fragmented to 150–200 bp fragments, then first and second strand cDNA were synthesized with a cDNA-synthesis kit (ThermoScientific), followed by end repair and adapter ligation. After 12 cycles of PCR enrichment, the quality

• Archives: SRS1038085 and SRS1038089. qRT-PCR analysis Total RNA was extracted using RNeasy Mini Kit (Qiagen) with on-column DNase digestion. The integrity, purity and concentration of the RNA were determined by NanoDrop spectrophotometry and Agilent 2200 TapeStation system. Quantitative reverse

• transcriptase PCR (qRT-PCR) was performed using a two-step method. First-strand cDNA was synthesized from total RNA using SuperScript III First-Strand Synthesis SuperMix kit (Cat. No. 18080-400, Invitrogen). The cDNA was used as a template for qRT-PCR with a SYBR Select Master Mix kit (Cat. No. 4472953, Applied

Non-native autoinducer analogs capable of modulating the SdiA quorum sensing receptor in Salmonella enterica serovar Typhimurium

• Matthew J. Styles and
• Helen E. Blackwell

Beilstein J. Org. Chem. 2018, 14, 2651–2664, doi:10.3762/bjoc.14.243

• ) promoter region (−330 to +147) from S. Typhimurium (14028) were cloned into pSC11, using the psrgE primers listed in Table 5 (cut sites are lowercase). 723 base pairs of sdiA from S. Typhimurium were cloned into pJN105, using the sdiA primers listed in Table 5 (cut sites are lowercase) [66]. PCR-generated

Impact of Pseudomonas aeruginosa quorum sensing signaling molecules on adhesion and inflammatory markers in endothelial cells

• Carmen Curutiu,
• Florin Iordache,
• Veronica Lazar,
• Aurelia Magdalena Pisoschi,
• Aneta Pop,
• Mariana Carmen Chifiriuc and
• Alina Maria Hoban

Beilstein J. Org. Chem. 2018, 14, 2580–2588, doi:10.3762/bjoc.14.235

• evaluated. The expression of adhesion molecules (VE-cadherin, PECAM-1, ICAM-1, and P-selectin) and inflammatory response molecules (IL-1β, IL-6, TNFα, TGFβ, and eNOS) was assessed by qRT-PCR and flow cytometry. Our results showed that bacterial adherence to inert substratum and biofilm were decreased in the

• molecules, while independent, with similar or different effects, act together [22]. The expression of adhesion molecules VE-cadherin and PECAM-1 was evaluated by qRT-PCR assay, and the obtained results sustained the flow cytometry data, suggesting the ability of QSSMs to modulate adhesion of host cells. An

• ), while C4HSL showed no significant effect in the modulation of IL-6 expression (Figure 4). QRT-PCR results showed that the presence of C4HSL, PQS and HHQ molecules increased the expression level of IL-1β, while the PAO1 and OdDHL did not affect the level of IL-1β. IL-6 expression was slightly increased

Mechanochemistry of nucleosides, nucleotides and related materials

• Olga Eguaogie,
• Joseph S. Vyle,
• Patrick F. Conlon,
• Manuela A. Gîlea and
• Yipei Liang

Beilstein J. Org. Chem. 2018, 14, 955–970, doi:10.3762/bjoc.14.81

• ) which were agitated using a membrane valve [80]. Within three minutes, almost complete disruption of Gram-positive bacteria was effected enabling downstream analysis by quantitative PCR. Associative processes Variable drug bioavailability associated with crystal and co-crystal polymorphism can be

Preparation of trinucleotide phosphoramidites as synthons for the synthesis of gene libraries

• Ruth Suchsland,
• Bettina Appel and
• Sabine Müller

Beilstein J. Org. Chem. 2018, 14, 397–406, doi:10.3762/bjoc.14.28

• generation of protein mutant libraries and high throughput screening processes to select for variants with improved traits. Protein mutant libraries are produced from gene libraries, which are generated by random mutagenesis at DNA level. Often polymerase chain raction (PCR)-based methods like error-prone

• PCR are used for this purpose as well as recombinant methods like DNA shuffling and related strategies [6][7]. One of the major challenges in gene library production is to generate libraries with a high number of promising candidates to enhance the chance of selecting functional protein variants. The

Fluorogenic PNA probes

• Tirayut Vilaivan

Beilstein J. Org. Chem. 2018, 14, 253–281, doi:10.3762/bjoc.14.17

• [24]. Overall, these properties enable the use of PNA for several applications, including therapeutics and diagnostics [25], and as a unique tool for DNA manipulation, such as PCR clamping [26] and PNA openers [27]. Ironically, the very same uncharged nature of PNA that is the basis of several of the

• binding domain and the stem part consisted of a chimeric PNA–DNA hybrid linked together by a disulfide bond (Figure 4). The chimeric beacon was immobilized to a microtiter plate via a biotin tag and was employed for the detection of PCR amplicons of rDNA from Entamoeba histolytica [41]. The use of PNA

• better specificity than DNA beacons. A PNA beacon has been used as a sensing probe for PCR amplicons in a droplet-based microfluidic device [78], while an integrated microfluidic device that combined sample preparation, hybridization and confocal fluorescence spectroscopy allowed amplification-free

Halogen-containing thiazole orange analogues – new fluorogenic DNA stains

• Aleksey A. Vasilev,
• Meglena I. Kandinska,
• Stanimir S. Stoyanov,
• Stanislava B. Yordanova,
• David Sucunza,
• Juan J. Vaquero,
• Obis D. Castaño,
• Stanislav Baluschev and
• Silvia E. Angelova

Beilstein J. Org. Chem. 2017, 13, 2902–2914, doi:10.3762/bjoc.13.283

• [12][13], DNA fragment sizing [14][15], as reporter groups in hybridization probes [16][17][18][19][20][21][22][23], single DNA molecule fluorescence microscopy [24][25], gel staining [26], in real-time PCR analysis [27][28]) because of their excellent staining properties. Unsymmetrical cyanines have

The chemistry and biology of mycolactones

• Matthias Gehringer and
• Karl-Heinz Altmann

Beilstein J. Org. Chem. 2017, 13, 1596–1660, doi:10.3762/bjoc.13.159

• relies on the experience of local health professionals. Subsequent laboratory testing to confirm the clinical diagnosis might then be performed by 1) direct smear examination for acid-fast bacilli; 2) in vitro culture; 3) polymerase chain reaction (PCR), targeting the genomic region IS2404; and 4

• bands. The method has been validated for a mouse footpad model of M. ulcerans infection [69] and for skin tissue samples from Buruli ulcer patients [70]. With a detection rate of 73%, TLC proved superior to microscopy (30–60%) or culture (35–60%) and comparable to histology (82%), but inferior to PCR

• -treated cells die by apoptosis. Interestingly, the addition of wiskostatin, which was previously shown to counteract cytotoxic effects of mycolactones [93], even enhanced mycolactone toxicity. By using a real-time PCR (qPCR) screening of 84 genes involved in the regulation of apoptosis, autophagy and

Versatile synthesis of the signaling peptide glorin

• Robert Barnett,
• Daniel Raszkowski,
• Thomas Winckler and
• Pierre Stallforth

Beilstein J. Org. Chem. 2017, 13, 247–250, doi:10.3762/bjoc.13.27

• activate glorin-induced genes in the social amoeba Polysphondylium pallidum was evaluated by quantitative reverse transcription PCR, whereby both compounds showed bioactivity comparable to a glorin standard. This synthetic route will be useful in conducting detailed structure–activity relationship studies

• -transcription PCR (RT-qPCR). Results and Discussion Synthesis of glorin and glorinamide Two glorin syntheses have been published [15][16], one of which lacked sufficient data to be reproducible and the other one displayed limited versatility. Therefore, we focused on designing a robust synthesis that would

• relationship study. Ultimately, we wish to synthesize chemical probes of glorin for the identification of the unknown glorin receptor. Experimental Quantitative reverse transcription PCR: P. pallidum PN500 cells were cultured in association with Escherichia coli K12 cells. Cells were harvested before first

A postsynthetically 2’-“clickable” uridine with arabino configuration and its application for fluorescent labeling and imaging of DNA

• Heidi-Kristin Walter,
• Bettina Olshausen,
• Ute Schepers and
• Hans-Achim Wagenknecht

Beilstein J. Org. Chem. 2017, 13, 127–137, doi:10.3762/bjoc.13.16

• DNA polymerases in primer extension experiments and PCR [4][16]. To develop fluorescently labelled oligonucleotides that undergo energy transfer reactions [17] we recently applied 2’-propargyl-modified uridine 1 as DNA building block (Scheme 1) [15][18][19]. A simple look on the three-dimensional

Biochemical and structural characterisation of the second oxidative crosslinking step during the biosynthesis of the glycopeptide antibiotic A47934

• Veronika Ulrich,
• Clara Brieke and
• Max J. Cryle

Beilstein J. Org. Chem. 2016, 12, 2849–2864, doi:10.3762/bjoc.12.284

• StaF was obtained from genomic DNA [33] and was amplified by PCR using specific primers (fwd: 5’-CACCATGTTCGAGGAGATCAACGTCGTC-3’, rev: 5’- CTACCAGTCGAGCAGCAGGGCTTC- 3’) for cloning into pET151d (Life Technologies) using TOPO-cloning. The plasmid was sequenced using T7 promoter and terminator primers

A detailed view on 1,8-cineol biosynthesis by Streptomyces clavuligerus

• Jan Rinkel,
• Patrick Rabe,
• Laura zur Horst and
• Jeroen S. Dickschat

Beilstein J. Org. Chem. 2016, 12, 2317–2324, doi:10.3762/bjoc.12.225

• (TCACCAAGGGGTGGTGGCCC). The isolated PCR product was elongated for homologous recombination with pYE-Express in yeast with a second set of primers (GGCAGCCATATGGCTAGCATGACTGGTGGAATGCCCGCCGGCCACGAAGA and TCTCAGTGGTGGTGGTGGTGGTGCTCGAGTTCACCAAGGGGTGGTGG CCC). This elongated product was transformed in Saccharomyces

Evidence for an iterative module in chain elongation on the azalomycin polyketide synthase

• Hui Hong,
• Yuhui Sun,
• Yongjun Zhou,
• Emily Stephens,
• Markiyan Samborskyy and
• Peter F. Leadlay

Beilstein J. Org. Chem. 2016, 12, 2164–2172, doi:10.3762/bjoc.12.206

• actinomycete strains. To check for significant deletions in clones housing the azl genes, PCR primer pairs were designed that would anneal approximately every 10 kbp within the gene cluster. The results were fully consistent with the whole gene cluster being present in E. coli ET12567 containing pML1. This

• strain was used for conjugation with S. lividans. Selection for apramycin resistance led to the isolation of exconjugants, four of which were analysed using PCR with two flanking and twelve internal PCR primer pairs. Two colonies were found which appeared to contain the full azl gene cluster while the

Marine-derived myxobacteria of the suborder Nannocystineae: An underexplored source of structurally intriguing and biologically active metabolites

• Antonio Dávila-Céspedes,
• Peter Hufendiek,
• Max Crüsemann,
• Till F. Schäberle and
• Gabriele M. König

Beilstein J. Org. Chem. 2016, 12, 969–984, doi:10.3762/bjoc.12.96

• provided insights into the structure–activity relationship of haliangicin were generated in this study [55]. The huge potential to synthesize novel metabolites in the genus Haliangium is further corroborated by a PCR screening-based study for PKS sequences in H. tepidum among other myxobacteria [56]. The

Muraymycin nucleoside-peptide antibiotics: uridine-derived natural products as lead structures for the development of novel antibacterial agents

• Daniel Wiegmann,
• Stefan Koppermann,
• Marius Wirth,
• Giuliana Niro,
• Kristin Leyerer and
• Christian Ducho

Beilstein J. Org. Chem. 2016, 12, 769–795, doi:10.3762/bjoc.12.77

• performed a PCR-based screening of a collection of ≈2500 actinomycete strains for similar transaldolase-encoding genes [129]. They could identify the gene sphJ from a Sphaerisporangium sp., which encoded the transaldolase SphJ having 51% amino acid sequence identity with LipK. Following detailed

Natural products from microbes associated with insects

• Christine Beemelmanns,
• Huijuan Guo,
• Maja Rischer and
• Michael Poulsen

Beilstein J. Org. Chem. 2016, 12, 314–327, doi:10.3762/bjoc.12.34

• resembles iterative enzymes normally only found in fungi. Subsequently, genomes of phylogenetically diverse bacteria from various environments were screened for the biosynthetic pathways of frontalamide-like compounds using a degenerate primer-based PCR screen. The respective gene clusters were broadly

Synthesis of α,β-unsaturated esters via a chemo-enzymatic chain elongation approach by combining carboxylic acid reduction and Wittig reaction

• Yitao Duan,
• Peiyuan Yao,
• Yuncheng Du,
• Jinhui Feng,
• Qiaqing Wu and
• Dunming Zhu

Beilstein J. Org. Chem. 2015, 11, 2245–2251, doi:10.3762/bjoc.11.243

• efficient amount of CoA, ATP and NADPH or effective regeneration systems of them. Experimental Cloning of Mycobacterium CAR gene Mycobacterium sp. chromosomal DNA (gDNA) was extracted and purified using a TIANamp Bacteria DNA Kit. The Mycobacterium CAR gene (Gene ID 17912504) was amplified by PCR using

• Mycobacterium gDNA as template and primers containing the restriction sites NdeI and XhoI, respectively, CAR-F 5′-CATGCATATGTTCGCCGAAAATCTTGATGACCAG-3′ and CAR-R 5′-CATCTCGA GCAGCAGGCCGAGCAATTGCAGGT-3′. The PCR fragment was purified and then ligated with cloning vector pJET1.2/blunt, which was confirmed by DNA

Engineering Pichia pastoris for improved NADH regeneration: A novel chassis strain for whole-cell catalysis

• Martina Geier,
• Christoph Brandner,
• Gernot A. Strohmeier,
• Mélanie Hall,
• Franz S. Hartner and
• Anton Glieder

Beilstein J. Org. Chem. 2015, 11, 1741–1748, doi:10.3762/bjoc.11.190

• the transformation of P. pastoris CBS7435 wild type cells according to the condensed protocol by Lin-Cereghino et al. [23]. Transformants were selected on YPD agar plates containing 100 mg/L ZeocinTM. The correct integration of the knock-out cassette was confirmed by PCR using genomic DNA as template

• plates to obtain single colonies. These were subsequently streaked out on YPD agar plates supplemented with 100 mg/L ZeocinTM to identify clones that had excised the cassette and, thus, were ZeocinTM-sensitive. The marker recycling was further validated by PCR using primers that bind in the genomic

• region directly up- and downstream of the deleted locus (see Supporting Information File 1, Table S3) and Sanger sequencing of the resulting PCR product. Growth rate studies Liquid Pichia cultures were grown in buffered minimal medium containing 200 mM KPi (pH 6.0), 13.4 g/L yeast nitrogen base and 0.4

DNA display of glycoconjugates to emulate oligomeric interactions of glycans

• Alexandre Novoa and
• Nicolas Winssinger

Beilstein J. Org. Chem. 2015, 11, 707–719, doi:10.3762/bjoc.11.81

• selection against immobilized DC-SIGN and analysis of the best-fit sample by PCR amplification/sequence analysis of the template led to the discovery of an assembly with a 30-fold enhancement in binding over the unmodified mannose assembly [44]. Importantly, following PCR amplification of the template, the

Effects of RAMEA-complexed polyunsaturated fatty acids on the response of human dendritic cells to inflammatory signals

• Éva Rajnavölgyi,
• Renáta Laczik,
• Viktor Kun,
• Lajos Szente and
• Éva Fenyvesi

Beilstein J. Org. Chem. 2014, 10, 3152–3160, doi:10.3762/bjoc.10.332

• , USA). Fluorescence intensities were measured with FACSCalibur (BD Biosciences). Data analysis was performed with the FlowJo software (Tree Star, Ashland, OR, USA). Determination of GPR120 expression levels GPR120 expression levels were measured by real-time quantitative PCR (Q-PCR). Total RNA was

• cyclophilin (Integrated DNA Technologies, Coralville, IA, USA). Q-PCR was performed using the ABI StepOne Real Time PCR System (Applied Biosystems) and cycle threshold values were determined by using the StepOne v2.1 Software (Applied Biosystems). Statistical analysis The results of flow cytometry, Q-PCR and

Autonomous assembly of synthetic oligonucleotides built from an expanded DNA alphabet. Total synthesis of a gene encoding kanamycin resistance

• Kristen K. Merritt,
• Kevin M. Bradley,
• Daniel Hutter,
• Mariko F. Matsuura,
• Diane J. Rowold and
• Steven A. Benner

Beilstein J. Org. Chem. 2014, 10, 2348–2360, doi:10.3762/bjoc.10.245

• overlapped assembly were then filled in using DNA polymerases, and the nicks were sealed by ligase. The S:B pairs in the ligated construct were then converted to T:A pairs during PCR amplification. When cloned into a plasmid, the product was shown to make Escherichia coli resistant to kanamycin. A parallel

• [7]. The cycle is then repeated until the full-length L-DNA product is achieved. With the advent of PCR, this strategy was adapted to the total synthesis of a gene encoding human leukocyte interferon [8] and a gene encoding ribonuclease S protein [9]. The second gene synthesis was the first to

• facilitate subsequent manipulation, add 'watermarks' to track the gene’s provenance, and choose codons to improve the expression of the gene [10]. This combination of automated synthesis of DNA fragments followed by their manual assembly, with PCR used to recover manually assembled partial constructs, began

Specific DNA duplex formation at an artificial lipid bilayer: fluorescence microscopy after Sybr Green I staining

• Emma Werz and
• Helmut Rosemeyer

Beilstein J. Org. Chem. 2014, 10, 2307–2321, doi:10.3762/bjoc.10.240

• ][22]. This bears the advantage that the target DNA – the presence or absence of which is going to be analysed – should not be labelled separately with a fluorochrome tag such as cyanine-5 (Cy5) or TAMRA, neither by chemical synthesis nor by a polymerase chain reaction (PCR). The chemical formulae (1–3

OligArch: A software tool to allow artificially expanded genetic information systems (AEGIS) to guide the autonomous self-assembly of long DNA constructs from multiple DNA single strands

• Kevin M. Bradley and
• Steven A. Benner

Beilstein J. Org. Chem. 2014, 10, 1826–1833, doi:10.3762/bjoc.10.192

• available as parts of artificially expanded genetic information systems (AEGIS), and tools are now available to generate entirely standard DNA from AEGIS DNA during PCR amplification. Here, we describe the OligArch (for "oligonucleotide architecting") software, an application that permits synthetic

• of Z. The P:C mismatch is enabled by the protonation of P (Figure 3). These mismatches can occur both in vitro using PCR [10] and in vivo, in an engineered strand of E. coli. While rules for conversion have complexities, in their simplest forms, the S:B and Z:P pairs are converted to C:G and T:A

• components are removed via PCR to leave an entirely natural final DNA product, which was both complete and fully functional [6]. With the successful synthesis of the kanamycin resistance gene, we show that the AEGIS bases can be used for autonomous self-assembly of large-scale sequences, with conversion back

Pyrene-modified PNAs: Stacking interactions and selective excimer emission in PNA₂DNA triplexes

• Alex Manicardi,
• Lucia Guidi,
• Alice Ghidini and
• Roberto Corradini

Beilstein J. Org. Chem. 2014, 10, 1495–1503, doi:10.3762/bjoc.10.154

• the fluorescence properties can be observed upon interaction with DNA, thus enabling to study the occurring interactions and to produce switching PNA probes. Fluorescent switching probes for DNA detection are very useful tools in diagnostics applications such as real-time PCR and in situ hybridisation

A new building block for DNA network formation by self-assembly and polymerase chain reaction

• Holger Bußkamp,
• Sascha Keller,
• Marta Robotta,
• Malte Drescher and
• Andreas Marx

Beilstein J. Org. Chem. 2014, 10, 1037–1046, doi:10.3762/bjoc.10.104

• network formation by enzymatic DNA synthesis. The Y-shaped 3-armed DNA construct, bearing 3 primer strands is accepted by Taq DNA polymerase. The enzyme uses each arm as primer strand and incorporates the branched construct into large assemblies during PCR. The networks were investigated by agarose gel

• hydrogels. Keywords: AFM; branched DNA; DNA; DNA polymerase; nanotechnology; nucleic acids; PCR; self-assembly; Introduction DNA has found applications in the field of nanotechnology due to its inherent properties. The simplicity and predictability of DNA secondary structure are of outstanding potential

• , the formed DNA networks are remarkably stabilized (up to 95 °C) compared to the non-branched counterparts. We previously reported an approach to construct three dimensional DNA networks that were generated and amplified by DNA polymerase chain reactions (PCR). In order to construct the network we