Search results

Search for "template" in Full Text gives 198 result(s) in Beilstein Journal of Organic Chemistry.

Rotaxanes with integrated photoswitches: design principles, functional behavior, and emerging applications

  • Jullyane Emi Matsushima,
  • Khushbu,
  • Zuliah Abdulsalam,
  • Udyogi Navodya Kulathilaka Conthagamage and
  • Víctor García-López

Beilstein J. Org. Chem. 2025, 21, 2345–2366, doi:10.3762/bjoc.21.179

Graphical Abstract
  • is suppressed, and the macrocycle becomes effectively immobilized. The process is reversible upon heating. Later, Tron and co-workers synthesized a [2]rotaxane containing a barbiturate moiety in the axle, which serves as a template for a reversible clipping approach [84]. The macrocycle precursor is
PDF
Album
Review
Published 31 Oct 2025

Enantioselective radical chemistry: a bright future ahead

  • Anna C. Renner,
  • Sagar S. Thorat,
  • Hariharaputhiran Subramanian and
  • Mukund P. Sibi

Beilstein J. Org. Chem. 2025, 21, 2283–2296, doi:10.3762/bjoc.21.174

Graphical Abstract
  • ) [40]. The reactions were catalyzed by chiral Lewis acids and involved conjugate addition of a nucleophilic alkyl radical to an α,β-unsaturated substrate containing an oxazolidinone or pyrrolidinone template. The resulting α-radical was trapped with an allylstannane and the addition and trapping
PDF
Album
Perspective
Published 28 Oct 2025

Solar thermal fuels: azobenzene as a cyclic photon–heat transduction platform

  • Jie Yan,
  • Shaodong Sun,
  • Minghao Wang and
  • Si Wu

Beilstein J. Org. Chem. 2025, 21, 2036–2047, doi:10.3762/bjoc.21.159

Graphical Abstract
  • . Grossman et al. synthesized azobenzene-functionalized single-walled carbon nanotubes (SWCNTs) (Figure 3a) and demonstrated their application as solar thermal fuels [43]. The conformational restriction imposed by the chromophore-template structure combined with photochemically generated spatial strain
  • development of azobenzene-based solar thermal fuels and demonstrated their potential applications. Nanocarbon-integrated azobenzene polymers: Their energy storage efficiency (up to >200%) and cycle life are primarily modulated by template confinement effects and electronic coupling. However, high costs and
PDF
Album
Perspective
Published 08 Oct 2025

Recent advances in synthetic approaches for bioactive cinnamic acid derivatives

  • Betty A. Kustiana,
  • Galuh Widiyarti and
  • Teni Ernawati

Beilstein J. Org. Chem. 2025, 21, 1031–1086, doi:10.3762/bjoc.21.85

Graphical Abstract
PDF
Album
Review
Published 28 May 2025

Photomechanochemistry: harnessing mechanical forces to enhance photochemical reactions

  • Francesco Mele,
  • Ana M. Constantin,
  • Andrea Porcheddu,
  • Raimondo Maggi,
  • Giovanni Maestri,
  • Nicola Della Ca’ and
  • Luca Capaldo

Beilstein J. Org. Chem. 2025, 21, 458–472, doi:10.3762/bjoc.21.33

Graphical Abstract
  • obtained as a single stereoisomer and in quantitative yield after 80 h of irradiation. The role of 2.2 is to create a close-packed environment via hydrogen-bond interactions where the [2 + 2] photodimerization can occur stereoselectively. Next, the authors evaluated the possibility of using the template
PDF
Album
Perspective
Published 03 Mar 2025

Beyond symmetric self-assembly and effective molarity: unlocking functional enzyme mimics with robust organic cages

  • Keith G. Andrews

Beilstein J. Org. Chem. 2025, 21, 421–443, doi:10.3762/bjoc.21.30

Graphical Abstract
  • least bicyclic in connectivity, whose minimal structure is comprised of covalent bonds. Organic cages have historically been synthesized using irreversible bond formation [236][237][238][239][240][241][242][243][244][245][246][247][248], sometimes with a template [45][249][250]. Following the
PDF
Album
Supp Info
Perspective
Published 24 Feb 2025

Visible-light-promoted radical cyclisation of unactivated alkenes in benzimidazoles: synthesis of difluoromethyl- and aryldifluoromethyl-substituted polycyclic imidazoles

  • Yujun Pang,
  • Jinglan Yan,
  • Nawaf Al-Maharik,
  • Qian Zhang,
  • Zeguo Fang and
  • Dong Li

Beilstein J. Org. Chem. 2025, 21, 234–241, doi:10.3762/bjoc.21.15

Graphical Abstract
  • with CF2HCOOH or PhCF2COOH, and PIDA under additive-, base-, and metal catalyst-free conditions (Scheme 1b). Results and Discussion Initially, 1-(pent-4-en-1-yl)-1H-benzo[d]imidazole (1a), CF2HCOOH, and PIDA were chosen as the template substrates for this radical difluoromethylation and cyclization
PDF
Album
Supp Info
Letter
Published 30 Jan 2025

Synthesis, structure and π-expansion of tris(4,5-dehydro-2,3:6,7-dibenzotropone)

  • Yongming Xiong,
  • Xue Lin Ma,
  • Shilong Su and
  • Qian Miao

Beilstein J. Org. Chem. 2025, 21, 1–7, doi:10.3762/bjoc.21.1

Graphical Abstract
  • definitively synthesized. The three-dimensional graphene-like carbons formed in a zeolite-template are the carbon forms that are the closest to carbon schwarzites so far [6][7]. Fragments of carbon schwarzites that retain their key structural characteristics are negatively curved polycyclic arenes [8][9
PDF
Album
Supp Info
Full Research Paper
Published 02 Jan 2025

Transition-metal-free decarbonylation–oxidation of 3-arylbenzofuran-2(3H)-ones: access to 2-hydroxybenzophenones

  • Bhaskar B. Dhotare,
  • Seema V. Kanojia,
  • Chahna K. Sakhiya,
  • Amey Wadawale and
  • Dibakar Goswami

Beilstein J. Org. Chem. 2024, 20, 2655–2667, doi:10.3762/bjoc.20.223

Graphical Abstract
  • -hydroxybenzophenone, has been widely used as a sun-protecting material in cosmetics [3]. Moreover, in general, 2-hydroxybenzophenones are regarded as an important ultraviolet absorber, as well as an important template in synthesis [4]. Mechanistically, it has been well accepted that 2-hydroxybenzophenones show UV
PDF
Album
Supp Info
Full Research Paper
Published 21 Oct 2024

Cell-free protein synthesis with technical additives – expanding the parameter space of in vitro gene expression

  • Tabea Bartsch,
  • Stephan Lütz and
  • Katrin Rosenthal

Beilstein J. Org. Chem. 2024, 20, 2242–2253, doi:10.3762/bjoc.20.192

Graphical Abstract
  • on the metabolism [6]. Furthermore, protein synthesis takes only a few hours [7], making the process very fast compared to heterologous expression. CFPS relies on the transcription and translation (TX-TL) system of the donor organism [8]. In addition, the reaction solution contains the DNA-template
PDF
Album
Supp Info
Full Research Paper
Published 04 Sep 2024

Computational toolbox for the analysis of protein–glycan interactions

  • Ferran Nieto-Fabregat,
  • Maria Pia Lenza,
  • Angela Marseglia,
  • Cristina Di Carluccio,
  • Antonio Molinaro,
  • Alba Silipo and
  • Roberta Marchetti

Beilstein J. Org. Chem. 2024, 20, 2084–2107, doi:10.3762/bjoc.20.180

Graphical Abstract
  • interaction with host proteins [5][6]. Notably, the complexity of the glycome far surpasses that of the genome, transcriptome, and proteome, not only due to the structural and conformational diversity of glycans, whose synthesis is not template driven, but also due to their dynamic nature [5][6]. Although
  • experimental data. Tools for protein structure prediction Due to the vast conformational space and a complex energy function, protein structure prediction (PSP) is a computationally challenging task. Homology modelling is a template-based PSP that may be used to predict the 3D structure of a protein based on
  • its amino acid sequence and the structure of a related protein that is already known. However, also template-free PSP has obtained significant progress recently via machine learning and search-based optimisation approaches [87]. There are several software programs and tools available for homology
PDF
Album
Review
Published 22 Aug 2024

Cage-like microstructures via sequential Ugi reactions in aqueous emulsions

  • Rita S. Alqubelat,
  • Yaroslava A. Menzorova and
  • Maxim A. Mironov

Beilstein J. Org. Chem. 2024, 20, 2078–2083, doi:10.3762/bjoc.20.179

Graphical Abstract
  • the formation of a double Pickering emulsion using a microfluidic technique. Solidification of this structure and removal of the template resulted in the formation of nonspherical capsules with large openings [13]. The use of a polymer matrix that can swell in an organic solvent made it possible to
PDF
Album
Supp Info
Letter
Published 22 Aug 2024

2-Heteroarylethylamines in medicinal chemistry: a review of 2-phenethylamine satellite chemical space

  • Carlos Nieto,
  • Alejandro Manchado,
  • Ángel García-González,
  • David Díez and
  • Narciso M. Garrido

Beilstein J. Org. Chem. 2024, 20, 1880–1893, doi:10.3762/bjoc.20.163

Graphical Abstract
  • invertebrates as neurotransmitter, in the so called histaminergic synapses [50]. As a consequence, histamine has been used as a template to rationally design histamine receptor agonists/antagonists capable to modulate their extensive range of capabilities. (R)-α-Methylhistamine (51) is an H3 receptor agonist
PDF
Album
Review
Published 02 Aug 2024

The Groebke–Blackburn–Bienaymé reaction in its maturity: innovation and improvements since its 21st birthday (2019–2023)

  • Cristina Martini,
  • Muhammad Idham Darussalam Mardjan and
  • Andrea Basso

Beilstein J. Org. Chem. 2024, 20, 1839–1879, doi:10.3762/bjoc.20.162

Graphical Abstract
  • template, selecting the ligand building blocks with highest affinity and bringing them in proximity within the binding site. Building blocks are opportunely chosen to have complementary reactivity and therefore to react irreversibly within the binding site and assemble into the final ligand. Before the
  • work described below, KTGS was applied to multicomponent reactions in limited cases [25]. Van der Veken et al. selected as template the protein urokinase plasminogen activator, a serine protease targeted in oncology and inhibited by imidazopyridines [26]. The main challenges of this project were the
  • combination of reactants was studied, but a major hurdle was found to be the imine formation step in aqueous media. Consequently, imines were first prepared as metastable adducts (with benzotriazole or p-TSA as stabilizers) and then tested with isocyanides in the presence of the template protein, involving
PDF
Album
Review
Published 01 Aug 2024

Synthetic applications of the Cannizzaro reaction

  • Bhaskar Chatterjee,
  • Dhananjoy Mondal and
  • Smritilekha Bera

Beilstein J. Org. Chem. 2024, 20, 1376–1395, doi:10.3762/bjoc.20.120

Graphical Abstract
  • in the appropriate vicinity for the reaction to take place in appreciably good yields (84%). The barium cation template is the key for the reaction, as is the base concentration for effective hydride transfer (Scheme 14) [29]. They also extended the scope of the intramolecular Cannizzaro reaction to
  • proposed strategy where the metal ion acts as the binding cation template for the intramolecular desymmetrization (Scheme 15) [82]. A similar highly efficient intramolecular Cannizzaro reaction of calix[4]arene dialdehydes was observed by Galli et al. where the 1,3-distal cone 35 significantly responded to
PDF
Album
Review
Published 19 Jun 2024

Novel analogues of a nonnucleoside SARS-CoV-2 RdRp inhibitor as potential antivirotics

  • Luca Julianna Tóth,
  • Kateřina Krejčová,
  • Milan Dejmek,
  • Eva Žilecká,
  • Blanka Klepetářová,
  • Lenka Poštová Slavětínská,
  • Evžen Bouřa and
  • Radim Nencka

Beilstein J. Org. Chem. 2024, 20, 1029–1036, doi:10.3762/bjoc.20.91

Graphical Abstract
  • antivirals. Structure of HeE1-2Tyr (1) and of the derivatives synthesized in this work. Analysis of inhibitory activity against SARS-CoV-2 RdRp using primer extension assay. A) Gel-based polymerase assay with a constant concentration of fluorescently labeled template/primer RNA (0.5 µM) and the polymerase
PDF
Album
Supp Info
Full Research Paper
Published 06 May 2024

Ortho-ester-substituted diaryliodonium salts enabled regioselective arylocyclization of naphthols toward 3,4-benzocoumarins

  • Ke Jiang,
  • Cheng Pan,
  • Limin Wang,
  • Hao-Yang Wang and
  • Jianwei Han

Beilstein J. Org. Chem. 2024, 20, 841–851, doi:10.3762/bjoc.20.76

Graphical Abstract
  • naphthols and substituted phenols. This method represents an efficient approach to access 3,4-benzocoumarin derivatives (Scheme 1c). Results and Discussion To start the study, we used 2-naphthol (1a) and 1.1 equivalents of ortho-methyl formate-substituted diaryliodonium salt 2a as template substrates. The
  • isolated as stable solids, whose structures were fully characterized by NMR spectroscopy. As shown in Table 3, we utilized 2-naphthol and 1-naphthol as template substrates to react with various unsymmetrical 2-ester-substituted diaryliodonium salts. Remarkably, iodonium salts 2 proved to be versatile in
  • of butylated hydroxytoluene (BHT) into the template reaction. Remarkably, we observed that the desired product was not formed, suggesting a radical pathway. Subsequently, we investigated the bond-formation sequence in the benzocyclization reaction. A possible intermediate of 3al’ was prepared and
PDF
Album
Supp Info
Letter
Published 18 Apr 2024

New variochelins from soil-isolated Variovorax sp. H002

  • Jabal Rahmat Haedar,
  • Aya Yoshimura and
  • Toshiyuki Wakimoto

Beilstein J. Org. Chem. 2024, 20, 692–700, doi:10.3762/bjoc.20.63

Graphical Abstract
  • amplified by PCR, using Variovorax sp. H002 genomic DNA as the template. The chloramphenicol-resistance gene (cmR) and a linearized recipient plasmid pRED were amplified by PCR, using pRED as the template. The primer sets used to amplify the above-mentioned four fragments are listed in Table S2 (Supporting
PDF
Album
Supp Info
Full Research Paper
Published 02 Apr 2024

A myo-inositol dehydrogenase involved in aminocyclitol biosynthesis of hygromycin A

  • Michael O. Akintubosun and
  • Melanie A. Higgins

Beilstein J. Org. Chem. 2024, 20, 589–596, doi:10.3762/bjoc.20.51

Graphical Abstract
  • Cloning, expression, and purification Streptomyces leeuwenhoekii NRRL B-24963 [28] was used as a template to amplify the hyg17 (GenBank CQR59633) with the primers 5’-GTTAGCCATATGACGGTCGCCGTCGTGGGC-3’ and 5’-GTAATGCTCGAGCGGCGCCACCGGCACCGA-3’. hyg17 was cloned into pTip-QC1 [10] using NdeI and XhoI
PDF
Album
Supp Info
Full Research Paper
Published 14 Mar 2024

Elucidating the glycan-binding specificity and structure of Cucumis melo agglutinin, a new R-type lectin

  • Jon Lundstrøm,
  • Emilie Gillon,
  • Valérie Chazalet,
  • Nicole Kerekes,
  • Antonio Di Maio,
  • Ten Feizi,
  • Yan Liu,
  • Annabelle Varrot and
  • Daniel Bojar

Beilstein J. Org. Chem. 2024, 20, 306–320, doi:10.3762/bjoc.20.31

Graphical Abstract
  • . This plasmid was obtained by PCR using pET-40b(+) (Novagen, Merck, #70091) as template and the following primers: forward (gcccagatctgggtaccGAAAACCTGTATTTTCAGGGCGccatggcgatatcgg) and reverse (GGTACCCAGATCTGGGCTGTCCATGTGCTGGC) with complementary sequence underlined. PCR was performed using PrimeSTAR DNA
  • (ACGCCATGGTGAGCCGTTCTACGC) and reverse (ATATCTCGAGTTAATCTG CCGTACCCCAGGATTGTGTAGG) and pET40b-TEV-CMA1 plasmid as template. Similarly, the C-terminal domain of CMA1 (136–264 in mature protein) was amplified by PCR using the subsequent primers: forward (ATTCCATGGGTCCGATTGTGGTTGCCATTGTTGG) and reverse
PDF
Album
Supp Info
Full Research Paper
Published 19 Feb 2024
Graphical Abstract
  • ratio of k4/k2 = 62. Consequently, it is posited that P assumes the role of a template, directing the arrangement of reactants in a precise manner conducive to the generation of C1. Leveraging the irreversibility inherent in the [2 + 2] CA–RE reaction, 1 can be adeptly employed as a proficient trapping
PDF
Album
Review
Published 22 Jan 2024

Facile access to pyridinium-based bent aromatic amphiphiles: nonionic surface modification of nanocarbons in water

  • Lorenzo Catti,
  • Shinji Aoyama and
  • Michito Yoshizawa

Beilstein J. Org. Chem. 2024, 20, 32–40, doi:10.3762/bjoc.20.5

Graphical Abstract
  • through the template effect of the hydrophobic nanocarbon guests (Table 2). Moreover, aromatic micelle (PA-Im)n and its host–guest composite (PA-Im)n·(C60)m were anticipated to provide pH-dependent ZPs via imidazole-based protonation/deprotonation. Micelle (PA-Im)n showed a significantly higher ZP (41.7
PDF
Album
Supp Info
Full Research Paper
Published 08 Jan 2024

NMRium: Teaching nuclear magnetic resonance spectra interpretation in an online platform

  • Luc Patiny,
  • Hamed Musallam,
  • Alejandro Bolaños,
  • Michaël Zasso,
  • Julien Wist,
  • Metin Karayilan,
  • Eva Ziegler,
  • Johannes C. Liermann and
  • Nils E. Schlörer

Beilstein J. Org. Chem. 2024, 20, 25–31, doi:10.3762/bjoc.20.4

Graphical Abstract
  • anywhere, the easiest way is to use a dedicated GitHub repository. We provide a repository template with a preconfigured action set that will create the JSON and table of content files for the users. The users only have to create a folder structure to define the hierarchy of their exercise set and put the
PDF
Album
Perspective
Published 05 Jan 2024

Identification of the p-coumaric acid biosynthetic gene cluster in Kutzneria albida: insights into the diazotization-dependent deamination pathway

  • Seiji Kawai,
  • Akito Yamada,
  • Yohei Katsuyama and
  • Yasuo Ohnishi

Beilstein J. Org. Chem. 2024, 20, 1–11, doi:10.3762/bjoc.20.1

Graphical Abstract
  • ) and 3-aminoavenalumic acid (7) were synthesized in our previous study [13]. Construction of heterologous expression vectors First, pHKO4-cmaI-D was constructed by cloning the cmaI-H-A1-A2-A3-A4-A5-A6-B-A7-E-D operon (which was amplified by PCR using K. albida genomic DNA as the template) into the NdeI
  • and HindIII sites of pHKO4 using In-Fusion (TaKaRa Bio Inc.) [20]. pTYM3a-cmaG was constructed by cloning cmaG (which was amplified by PCR using K. albida genomic DNA as the template) into the NdeI and XbaI sites of pTYM3a using In-Fusion (TaKaRa Bio Inc.). The primers used for plasmid construction
  • NMR system (JEOL, Tokyo, Japan) (Table S1 and Figures S9–S13 in Supporting Information File 1). Production and purification of recombinant proteins pColdI-cmaA1, pColdI-cmaA3, and pColdI-cmaA6 were constructed by cloning each gene (which was amplified by PCR using pHKO4-cmaI-D as a template) into the
PDF
Album
Supp Info
Full Research Paper
Published 02 Jan 2024

Long oligodeoxynucleotides: chemical synthesis, isolation via catching-by-polymerization, verification via sequencing, and gene expression demonstration

  • Yipeng Yin,
  • Reed Arneson,
  • Alexander Apostle,
  • Adikari M. D. N. Eriyagama,
  • Komal Chillar,
  • Emma Burke,
  • Martina Jahfetson,
  • Yinan Yuan and
  • Shiyue Fang

Beilstein J. Org. Chem. 2023, 19, 1957–1965, doi:10.3762/bjoc.19.146

Graphical Abstract
  • automated de novo synthesis of long ODNs would solve or alleviate many of these problems. Significant efforts have been made toward de novo synthesis of long ODNs through engineering of template-independent terminal deoxynucleotidyl transferase (TdT) [17]. While promising, this enzymatic method is unlikely
  • commercial sources, we converted our synthetic 399 and 401 nt ssODNs to dsODNs with PCR. For authentic dsODNs, we purchased the 800 bp GFP gene from a commercial source. Using the gene as the template, the authentic 399 and 401 bp dsODNs were obtained with PCR. The dsODNs derived from synthesized ssODNs were
  • 800 bp (C) dsODNs derived from synthetic 399 and 401 nt ssODNs. (A) Lane 1: 399 bp dsODN obtained with PCR using 399 nt ssODN as template. The ssODN was synthesized de novo on an automated synthesizer and purified with CBP. Lane 2: control 399 bp dsODN obtained with PCR using commercial 800 bp dsODN
PDF
Album
Supp Info
Full Research Paper
Published 21 Dec 2023
Other Beilstein-Institut Open Science Activities