Ortho-ester-substituted diaryliodonium salts enabled regioselective arylocyclization of naphthols toward 3,4-benzocoumarins

• Ke Jiang,
• Cheng Pan,
• Limin Wang,
• Hao-Yang Wang and
• Jianwei Han

Beilstein J. Org. Chem. 2024, 20, 841–851, doi:10.3762/bjoc.20.76

• naphthols and substituted phenols. This method represents an efficient approach to access 3,4-benzocoumarin derivatives (Scheme 1c). Results and Discussion To start the study, we used 2-naphthol (1a) and 1.1 equivalents of ortho-methyl formate-substituted diaryliodonium salt 2a as template substrates. The

• isolated as stable solids, whose structures were fully characterized by NMR spectroscopy. As shown in Table 3, we utilized 2-naphthol and 1-naphthol as template substrates to react with various unsymmetrical 2-ester-substituted diaryliodonium salts. Remarkably, iodonium salts 2 proved to be versatile in

• of butylated hydroxytoluene (BHT) into the template reaction. Remarkably, we observed that the desired product was not formed, suggesting a radical pathway. Subsequently, we investigated the bond-formation sequence in the benzocyclization reaction. A possible intermediate of 3al’ was prepared and

New variochelins from soil-isolated Variovorax sp. H002

• Jabal Rahmat Haedar,
• Aya Yoshimura and
• Toshiyuki Wakimoto

Beilstein J. Org. Chem. 2024, 20, 692–700, doi:10.3762/bjoc.20.63

• amplified by PCR, using Variovorax sp. H002 genomic DNA as the template. The chloramphenicol-resistance gene (cmR) and a linearized recipient plasmid pRED were amplified by PCR, using pRED as the template. The primer sets used to amplify the above-mentioned four fragments are listed in Table S2 (Supporting

A myo-inositol dehydrogenase involved in aminocyclitol biosynthesis of hygromycin A

• Michael O. Akintubosun and
• Melanie A. Higgins

Beilstein J. Org. Chem. 2024, 20, 589–596, doi:10.3762/bjoc.20.51

• Cloning, expression, and purification Streptomyces leeuwenhoekii NRRL B-24963 [28] was used as a template to amplify the hyg17 (GenBank CQR59633) with the primers 5’-GTTAGCCATATGACGGTCGCCGTCGTGGGC-3’ and 5’-GTAATGCTCGAGCGGCGCCACCGGCACCGA-3’. hyg17 was cloned into pTip-QC1 [10] using NdeI and XhoI

Elucidating the glycan-binding specificity and structure of Cucumis melo agglutinin, a new R-type lectin

• Jon Lundstrøm,
• Emilie Gillon,
• Valérie Chazalet,
• Nicole Kerekes,
• Antonio Di Maio,
• Ten Feizi,
• Yan Liu,
• Annabelle Varrot and
• Daniel Bojar

Beilstein J. Org. Chem. 2024, 20, 306–320, doi:10.3762/bjoc.20.31

• . This plasmid was obtained by PCR using pET-40b(+) (Novagen, Merck, #70091) as template and the following primers: forward (gcccagatctgggtaccGAAAACCTGTATTTTCAGGGCGccatggcgatatcgg) and reverse (GGTACCCAGATCTGGGCTGTCCATGTGCTGGC) with complementary sequence underlined. PCR was performed using PrimeSTAR DNA

• (ACGCCATGGTGAGCCGTTCTACGC) and reverse (ATATCTCGAGTTAATCTG CCGTACCCCAGGATTGTGTAGG) and pET40b-TEV-CMA1 plasmid as template. Similarly, the C-terminal domain of CMA1 (136–264 in mature protein) was amplified by PCR using the subsequent primers: forward (ATTCCATGGGTCCGATTGTGGTTGCCATTGTTGG) and reverse

Perspectives on push–pull chromophores derived from click-type [2 + 2] cycloaddition–retroelectrocyclization reactions of electron-rich alkynes and electron-deficient alkenes

• Michio Yamada

Beilstein J. Org. Chem. 2024, 20, 125–154, doi:10.3762/bjoc.20.13

• ratio of k4/k2 = 62. Consequently, it is posited that P assumes the role of a template, directing the arrangement of reactants in a precise manner conducive to the generation of C1. Leveraging the irreversibility inherent in the [2 + 2] CA–RE reaction, 1 can be adeptly employed as a proficient trapping

Facile access to pyridinium-based bent aromatic amphiphiles: nonionic surface modification of nanocarbons in water

• Lorenzo Catti,
• Shinji Aoyama and
• Michito Yoshizawa

Beilstein J. Org. Chem. 2024, 20, 32–40, doi:10.3762/bjoc.20.5

• through the template effect of the hydrophobic nanocarbon guests (Table 2). Moreover, aromatic micelle (PA-Im)n and its host–guest composite (PA-Im)n·(C60)m were anticipated to provide pH-dependent ZPs via imidazole-based protonation/deprotonation. Micelle (PA-Im)n showed a significantly higher ZP (41.7

NMRium: Teaching nuclear magnetic resonance spectra interpretation in an online platform

• Luc Patiny,
• Hamed Musallam,
• Alejandro Bolaños,
• Michaël Zasso,
• Julien Wist,
• Metin Karayilan,
• Eva Ziegler,
• Johannes C. Liermann and
• Nils E. Schlörer

Beilstein J. Org. Chem. 2024, 20, 25–31, doi:10.3762/bjoc.20.4

• anywhere, the easiest way is to use a dedicated GitHub repository. We provide a repository template with a preconfigured action set that will create the JSON and table of content files for the users. The users only have to create a folder structure to define the hierarchy of their exercise set and put the

Identification of the p-coumaric acid biosynthetic gene cluster in Kutzneria albida: insights into the diazotization-dependent deamination pathway

• Seiji Kawai,
• Akito Yamada,
• Yohei Katsuyama and
• Yasuo Ohnishi

Beilstein J. Org. Chem. 2024, 20, 1–11, doi:10.3762/bjoc.20.1

• ) and 3-aminoavenalumic acid (7) were synthesized in our previous study [13]. Construction of heterologous expression vectors First, pHKO4-cmaI-D was constructed by cloning the cmaI-H-A1-A2-A3-A4-A5-A6-B-A7-E-D operon (which was amplified by PCR using K. albida genomic DNA as the template) into the NdeI

• and HindIII sites of pHKO4 using In-Fusion (TaKaRa Bio Inc.) [20]. pTYM3a-cmaG was constructed by cloning cmaG (which was amplified by PCR using K. albida genomic DNA as the template) into the NdeI and XbaI sites of pTYM3a using In-Fusion (TaKaRa Bio Inc.). The primers used for plasmid construction

• NMR system (JEOL, Tokyo, Japan) (Table S1 and Figures S9–S13 in Supporting Information File 1). Production and purification of recombinant proteins pColdI-cmaA1, pColdI-cmaA3, and pColdI-cmaA6 were constructed by cloning each gene (which was amplified by PCR using pHKO4-cmaI-D as a template) into the

Long oligodeoxynucleotides: chemical synthesis, isolation via catching-by-polymerization, verification via sequencing, and gene expression demonstration

• Yipeng Yin,
• Reed Arneson,
• Alexander Apostle,
• Adikari M. D. N. Eriyagama,
• Komal Chillar,
• Emma Burke,
• Martina Jahfetson,
• Yinan Yuan and
• Shiyue Fang

Beilstein J. Org. Chem. 2023, 19, 1957–1965, doi:10.3762/bjoc.19.146

• automated de novo synthesis of long ODNs would solve or alleviate many of these problems. Significant efforts have been made toward de novo synthesis of long ODNs through engineering of template-independent terminal deoxynucleotidyl transferase (TdT) [17]. While promising, this enzymatic method is unlikely

• commercial sources, we converted our synthetic 399 and 401 nt ssODNs to dsODNs with PCR. For authentic dsODNs, we purchased the 800 bp GFP gene from a commercial source. Using the gene as the template, the authentic 399 and 401 bp dsODNs were obtained with PCR. The dsODNs derived from synthesized ssODNs were

• 800 bp (C) dsODNs derived from synthetic 399 and 401 nt ssODNs. (A) Lane 1: 399 bp dsODN obtained with PCR using 399 nt ssODN as template. The ssODN was synthesized de novo on an automated synthesizer and purified with CBP. Lane 2: control 399 bp dsODN obtained with PCR using commercial 800 bp dsODN

Active-metal template clipping synthesis of novel [2]rotaxanes

• Cătălin C. Anghel,
• Teodor A. Cucuiet,
• Niculina D. Hădade and
• Ion Grosu

Beilstein J. Org. Chem. 2023, 19, 1776–1784, doi:10.3762/bjoc.19.130

• beautiful structures and intriguing properties. We present herein a new synthetic strategy to access [2]rotaxanes, namely active-metal template clipping. We discuss the design of the target [2]rotaxanes, synthesis and characterization of the axle, macrocycle precursors and macrocycles as well as preparation

• of the final [2]rotaxanes by active template copper(I)-catalyzed alkyne–azide cycloaddition (CuAAC) as key step of the synthesis. HRMS and NMR experiments have been performed to confirm the formation of the interlocked structures. Keywords: active-metal template; clipping; copper(I)-catalyzed alkyne

• active-metal template strategies [12][13][14][15][16][17][18][19][20][21][22][23]. Other known methods are shrinking [24][25], swelling [26] or hydrogen-bond-mediated transition state stabilization [27][28][29], the latter resembling active-metal template synthesis. Regardless of the method used, the

Tying a knot between crown ethers and porphyrins

• Maksym Matviyishyn and
• Bartosz Szyszko

Beilstein J. Org. Chem. 2023, 19, 1630–1650, doi:10.3762/bjoc.19.120

• of the research on crowned porphyrins, the Bowman-James group worked on developing a new type of porphyrinoids called accordion porphyrins. Their seminal contribution, published in 1984, demonstrated a facile synthesis of an imine-linked tetrapyrrole macrocycle in the presence of a metal template and

• accordion porphyrins with various linkers [54][125]. Their formation typically relied on a template synthesis approach [126][127]. The first reported accordion porphyrin was synthesised as a binucleated lead(II) complex 13 (Scheme 4) [52]. The reaction of diformyldipyrromethane 12, lead(II) thiocyanate, and

Lewis acid-promoted direct synthesis of isoxazole derivatives

• Dengxu Qiu,
• Chenhui Jiang,
• Pan Gao and
• Yu Yuan

Beilstein J. Org. Chem. 2023, 19, 1562–1567, doi:10.3762/bjoc.19.113

• Dengxu Qiu Chenhui Jiang Pan Gao Yu Yuan College of Chemistry and Chemical Engineering, Yangzhou University, Yangzhou 225002, China 10.3762/bjoc.19.113 Abstract Isoxazole derivatives were synthesized via a one-pot method utilizing 2-methylquinoline derivatives as template substrates, sodium

Strategies in the synthesis of dibenzo[b,f]heteropines

• David I. H. Maier,
• Barend C. B. Bezuidenhoudt and
• Charlene Marais

Beilstein J. Org. Chem. 2023, 19, 700–718, doi:10.3762/bjoc.19.51

• dibenzo[b,f]heteropine template is an important feature in several commercial and lead active pharmaceutical ingredients, biologically active natural products, dyes in OLEDs and dye sensitive solar cells, and in certain ligands. This review provides an overview of the different synthetic strategies

A new oxidatively stable ligand for the chiral functionalization of amino acids in Ni(II)–Schiff base complexes

• Alena V. Dmitrieva,
• Oleg A. Levitskiy,
• Yuri K. Grishin and
• Tatiana V. Magdesieva

Beilstein J. Org. Chem. 2023, 19, 566–574, doi:10.3762/bjoc.19.41

• derived from glycine Schiff bases containing a source of chirality is the most convenient and widely used template for modification of the glycine fragment under mild conditions. The template can be easily obtained via self-assembly of the starting components in the presence of metal ions (commonly Ni(II

• ][17][18]). In early works, the chiral tridentate ligand based on (S)-N-benzylproline (L1) was used [19][20]. Though the original Belokon complex derived from N-benzylproline and o-aminobenzophenone showed sufficiently high efficiency and is still the most widely used template, considerable efforts on

• the modification of the chiral auxiliaries as well as of the other fragments of the tridentate ligand have been made to improve stereocontrolling efficiency and to modify physicochemical properties of the template (such as solubility, lipophilicity, etc). Thus, various substituents (4,5-di-CH3 [21], 2

Cyclometalated iridium complexes-catalyzed acceptorless dehydrogenative coupling reaction: construction of quinoline derivatives and evaluation of their antimicrobial activities

• Hongling Shui,
• Yuhong Zhong,
• Renshi Luo,
• Zhanyi Zhang,
• Jiuzhong Huang,
• Ping Yang and
• Nianhua Luo

Beilstein J. Org. Chem. 2022, 18, 1507–1517, doi:10.3762/bjoc.18.159

• further extend the practicality of the catalytic system. Firstly, we carried out a gram-scale reaction with the template reaction under the optimal catalytic system, which delivered quinoline 3aa in 94% isolated yield (Figure 3a). Additionally, the 2-furanquoline product 3ai was also obtained up to a gram

1,4,6,10-Tetraazaadamantanes (TAADs) with N-amino groups: synthesis and formation of boron chelates and host–guest complexes

• Artem N. Semakin,
• Ivan S. Golovanov,
• Yulia V. Nelyubina and
• Alexey Yu. Sukhorukov

Beilstein J. Org. Chem. 2022, 18, 1424–1434, doi:10.3762/bjoc.18.148

• molecule is fixed by a system of H-bonds in a pocket created by amide units and the triazinane ring. This creates opportunities for a rational design of supramolecular receptors for alcohols based on 3N-TAAD as a template. Adamantane-based tripodal scaffolds and current work. General view of the 1,4,6,10

Characterization of a new fusicoccane-type diterpene synthase and an associated P450 enzyme

• Jia-Hua Huang,
• Jian-Ming Lv,
• Liang-Yan Xiao,
• Qian Xu,
• Fu-Long Lin,
• Gao-Qian Wang,
• Guo-Dong Chen,
• Sheng-Ying Qin,
• Dan Hu and
• Hao Gao

Beilstein J. Org. Chem. 2022, 18, 1396–1402, doi:10.3762/bjoc.18.144

• might adopt a similar strategy as MgMS to initiate C2,6 cyclization though protonation at C2 by bulky water. To obtain further insights into the C2,6-cyclization process of TadA, its three-dimensional (3D) protein structure was constructed with SWISS-MODEL using PaFS (PDB entry 5er8) as the template

Reductive opening of a cyclopropane ring in the Ni(II) coordination environment: a route to functionalized dehydroalanine and cysteine derivatives

• Oleg A. Levitskiy,
• Olga I. Aglamazova,
• Yuri K. Grishin and
• Tatiana V. Magdesieva

Beilstein J. Org. Chem. 2022, 18, 1166–1176, doi:10.3762/bjoc.18.121

• -activity and chirality provided by the Ni–Schiff base template, supported with the protection from redox-destruction of the amino acid skeleton, makes the suggested approach a convenient route to various types of non-proteinogenic amino acids [9][10][12][13]. Recently, several practical approaches to α,α

• sphere. Notably, the Ni template is an important component of the reaction. It is responsible for chirality induction and facilitates the cyclopropane ring opening, significantly decreasing the reduction potential value. It stabilizes the anion formed and serves as a directing group. Thus, the Ni–Schiff

Electrochemical and spectroscopic properties of twisted dibenzo[g,p]chrysene derivatives

• Tomoya Imai,
• Ryuhei Akasaka,
• Naruhiro Yoshida,
• Toru Amaya and
• Tetsuo Iwasawa

Beilstein J. Org. Chem. 2022, 18, 963–971, doi:10.3762/bjoc.18.96

• strategy for preparing DBC derivatives using DBC-H with four isopropyl groups at X as a key template for the derivatization (Figure 1c). Based on this strategy, various substituents were introduced at Z to produce DBC-Br, DBC-Me, DBC-SMe, DBC-S(O)2Me, and DBC-Si (Figure 1c) [52]. The structures of all

Morita–Baylis–Hillman reaction of 3-formyl-9H-pyrido[3,4-b]indoles and fluorescence studies of the products

• Nisha Devi and
• Virender Singh

Beilstein J. Org. Chem. 2022, 18, 926–934, doi:10.3762/bjoc.18.92

• 3-formyl-β-carbolines are decorated with different sites for diversification which make these synthons a promising template for the construction of β-carboline-fused frameworks via C-1 N-9, C-1 N-2 and C-3 N-2 cyclisation. Similarly, β-carboline-substituted molecular frameworks can be generated at C

Identification of the new prenyltransferase Ubi-297 from marine bacteria and elucidation of its substrate specificity

• Jamshid Amiri Moghaddam,
• Huijuan Guo,
• Karsten Willing,
• Thomas Wichard and
• Christine Beemelmanns

Beilstein J. Org. Chem. 2022, 18, 722–731, doi:10.3762/bjoc.18.72

• (shown in green) and template structure (shown in blue). 8-HQA (pink) is paired to 4-HBA (green) after energy minimization. Evaluation of substrate specificity of UbiA-297. Accepted substrates are shown in red, while no product formation was observed for compounds colored in blue. HRMS signal intensities

Heteroleptic metallosupramolecular aggregates/complexation for supramolecular catalysis

• Prodip Howlader and
• Michael Schmittel

Beilstein J. Org. Chem. 2022, 18, 597–630, doi:10.3762/bjoc.18.62

• ], Fujita [56], and others [57] have reported several template-free assemblies giving access to novel structures. The primary objective of these nanovessels as supramolecular catalysts is to encapsulate organic reactant/s to lower the activation barrier, thereby mimicking the functions of enzymes (without

BINOL as a chiral element in mechanically interlocked molecules

• Matthias Krajnc and
• Jochen Niemeyer

Beilstein J. Org. Chem. 2022, 18, 508–523, doi:10.3762/bjoc.18.53

• applications as molecular switches, muscles, and motors [5][6][7][8][9][10][11], as novel materials [12], as medically active compounds [13][14], as catalysts [15][16][17][18][19], as chemosensors [20][21][22][23][24], and many more [25]. In view of their template-based synthesis and the importance of

• Incorporating BINOL into MIMs The introduction of axially chiral BINOL units into interlocked compounds can be achieved by different types of supramolecular template strategies that have been developed for MIM synthesis in the past decades, including passive metal templates [33][34], active metal templates [35

• ][36][37][38], anion templates [39][40], ammonium crown ether templates [41], and templates based on π–π interactions [42]. In 2004, Sauvage and co-workers have used a Cu(I)-based passive metal template approach to synthesize a [2]catenane containing an optically pure BINOL unit in each macrocycle [43

Site-selective reactions mediated by molecular containers

• Rui Wang and
• Yang Yu

Beilstein J. Org. Chem. 2022, 18, 309–324, doi:10.3762/bjoc.18.35

• , directing groups are introduced to the substrates covalently to achieve site-selective C–H bond activation, which prospered greatly in the past decades [7][8][9]. Template regulation is also introduced to locate reactive centers in a noncovalent way through hydrogen bonding [10][11][12]. Even though

• organic compounds. Within the molecular container, guest molecules can be encapsulated with a certain orientation and conformation through various noncovalent interactions. In this mode, the molecular container can act as reaction template and give rise to selective products. For example, the molecular

• container can be used as anchoring template, which fix the substrate with a certain stable conformation, exposing one specific reactive site to the catalyst and producing site-selective product [25][26]. Moreover, molecular containers have more and more been applied to modulate site-selectivity of different

Peptide stapling by late-stage Suzuki–Miyaura cross-coupling

• Hendrik Gruß,
• Rebecca C. Feiner,
• Ridhiwan Mseya,
• David C. Schröder,
• Michał Jewgiński,
• Kristian M. Müller,
• Rafał Latajka,
• Antoine Marion and
• Norbert Sewald

Beilstein J. Org. Chem. 2022, 18, 1–12, doi:10.3762/bjoc.18.1

• Supporting Information File 1, Figure S4). As a conclusion from those experiments, it was hypothesised that the linker might be too rigid resulting in a distorted structure, which has also been previously reported for thioether cross-linked cysteines bearing a biphenyl template within the staple [20]. Hence