Search results

Search for "DNA" in Full Text gives 406 result(s) in Beilstein Journal of Organic Chemistry. Showing first 200.

Natural resorcylic lactones derived from alternariol

  • Joachim Podlech

Beilstein J. Org. Chem. 2024, 20, 2171–2207, doi:10.3762/bjoc.20.187

Graphical Abstract
  • , preferentially affecting the IIα isoform [88], where on the other hand the damage turned out to be repaired in less than two hours [89]. Its induction of oxidative stress leading to DNA damage [90][91][92][93] and its causing cell cycle arrest, apoptosis, and changing the cell morphology further contribute to
  • hepatoma cells dependent on the aryl hydrocarbon receptor [96], and significantly increased the rate of DNA strand breaks in human carcinoma cells (HT29, A431) at concentrations ≥1 μM [88]. A reported mutagenicity against Salmonella typhimurium strains TA98 [80] was later revised and attributed to
  • contamination with the strongly mutagenic altertoxins [82][83]. When administered to rats, AME induced gene mutations, chromosome breakage, and DNA damage [114]. AME turned out to be active against bacteria (Bacillus subtilis, Staphylococcus haemolyticus, Agrobacterium tumefaciens, Pseudomonas lachrymans
PDF
Album
Supp Info
Review
Published 30 Aug 2024

Computational toolbox for the analysis of protein–glycan interactions

  • Ferran Nieto-Fabregat,
  • Maria Pia Lenza,
  • Angela Marseglia,
  • Cristina Di Carluccio,
  • Antonio Molinaro,
  • Alba Silipo and
  • Roberta Marchetti

Beilstein J. Org. Chem. 2024, 20, 2084–2107, doi:10.3762/bjoc.20.180

Graphical Abstract
  • is a docking (not free) program that models interactions between proteins and other biomolecules such as DNA, RNA, and small ligands. Originally designed for protein docking, it has been successfully adapted for GAGs due to its coarse-grained force field approach, which allows for protein flexibility
PDF
Album
Review
Published 22 Aug 2024

Understanding X-ray-induced isomerisation in photoswitchable surfactant assemblies

  • Beatrice E. Jones,
  • Camille Blayo,
  • Jake L. Greenfield,
  • Matthew J. Fuchter,
  • Nathan Cowieson and
  • Rachel C. Evans

Beilstein J. Org. Chem. 2024, 20, 2005–2015, doi:10.3762/bjoc.20.176

Graphical Abstract
  • hydrophilicity [6]. This, in turn, affects the interfacial and self-assembly properties of the PS [4][5][6]. The uniquely tuneable properties of these photoswitchable molecules have led to their successful application in areas such as DNA compaction [8], photorheological fluids [9][10] and micellar catalysis [11
PDF
Album
Supp Info
Full Research Paper
Published 14 Aug 2024

Negishi-coupling-enabled synthesis of α-heteroaryl-α-amino acid building blocks for DNA-encoded chemical library applications

  • Matteo Gasparetto,
  • Balázs Fődi and
  • Gellért Sipos

Beilstein J. Org. Chem. 2024, 20, 1922–1932, doi:10.3762/bjoc.20.168

Graphical Abstract
  • crucial function in many biological processes. Due to their bifunctional character, they have been also used for combinatorial chemistry purposes, such as the preparation of DNA-encoded chemical libraries. We developed a practical synthesis for α-heteroaryl-α-amino acids starting from an array of small
  • heteroaromatic halides. The reaction sequence utilizes a photochemically enhanced Negishi cross-coupling as a key step, followed by oximation and reduction. The prepared amino esters were validated for on-DNA reactivity via a reverse amidation–hydrolysis–reverse amidation protocol. Keywords: amino acids; DEL
  • ; flow chemistry; Negishi; on-DNA chemistry; Introduction DNA-encoded chemical library (DEL) technology is a powerful tool for hit identification [1][2]. DELs are chemically synthesized libraries in which every member is covalently attached to a unique DNA sequence serving as a molecular “barcode” [3
PDF
Album
Supp Info
Full Research Paper
Published 08 Aug 2024

The Groebke–Blackburn–Bienaymé reaction in its maturity: innovation and improvements since its 21st birthday (2019–2023)

  • Cristina Martini,
  • Muhammad Idham Darussalam Mardjan and
  • Andrea Basso

Beilstein J. Org. Chem. 2024, 20, 1839–1879, doi:10.3762/bjoc.20.162

Graphical Abstract
  • allow the reaction to take place under the mildest possible conditions. This search goes in parallel with the urge to use increasingly diverse and complex building blocks, up to and including DNA conjugates, which would be degraded under the classical conditions developed by Groebke, Blackburn and
  • . Brunschweiger et al. employed the compartmentation strategy to overcome synthetic problems related to the preparation of a DNA-encoded GBB library [17]. DNA-encoded libraries (DELs) are widely used in screening projects, allowing the synthesis of a huge number of compounds as pools, and the identification of
  • active ones by DNA sequencing. Great challenges, however, characterize the synthetic methodologies, since the chemistry must display a broad scope, be compatible with water and operationally simple, and preserve the genetic information (i.e., no harsh conditions, strongly acidic pHs, no oxidants or Lewis
PDF
Album
Review
Published 01 Aug 2024

Hetero-polycyclic aromatic systems: A data-driven investigation of structure–property relationships

  • Sabyasachi Chakraborty,
  • Eduardo Mayo Yanes and
  • Renana Gershoni-Poranne

Beilstein J. Org. Chem. 2024, 20, 1817–1830, doi:10.3762/bjoc.20.160

Graphical Abstract
  • prevalent classes of molecules known to humankind; indeed, it is estimated that two-thirds of known molecules contain (or are themselves) an aromatic moiety [1]. In addition to their presence in naturally occurring molecules, such as DNA and proteins, they have also been harnessed for various uses, ranging
PDF
Album
Supp Info
Full Research Paper
Published 31 Jul 2024

Syntheses and medicinal chemistry of spiro heterocyclic steroids

  • Laura L. Romero-Hernández,
  • Ana Isabel Ahuja-Casarín,
  • Penélope Merino-Montiel,
  • Sara Montiel-Smith,
  • José Luis Vega-Báez and
  • Jesús Sandoval-Ramírez

Beilstein J. Org. Chem. 2024, 20, 1713–1745, doi:10.3762/bjoc.20.152

Graphical Abstract
  • . Chromatographic purification was not required post-reaction. Some spiro products exhibited high binding affinity towards DNA, while others showed good cytotoxicity against different cancer cells (A545, MCF-7, HeLa, HL-60, SW480, HepG2, HT-29, and A549) with IC50 values within the micromolar range (2.18–18.54 µM
  • synthesized compounds were evaluated for their DNA binding properties and screened for cytotoxicity against leukemia cancer cells (Jurkat), demonstrating IC50 values in the micromolar range (14.2 to 36.5 µM). Importantly, these derivatives exhibited minimal toxicity toward normal cells (PBMCs). Furthermore
PDF
Album
Review
Published 24 Jul 2024

Methyltransferases from RiPP pathways: shaping the landscape of natural product chemistry

  • Maria-Paula Schröder,
  • Isabel P.-M. Pfeiffer and
  • Silja Mordhorst

Beilstein J. Org. Chem. 2024, 20, 1652–1670, doi:10.3762/bjoc.20.147

Graphical Abstract
  • pathways Methyltransferases can be classified based on various factors, such as their substrates (small molecule MTs, protein MTs, or RNA/DNA MTs), the atom that accepts the methyl group (oxygen = O-MTs, nitrogen = N-MTs, carbon = C-MTs, sulphur = S-MTs, or halide = H-MTs), metal or cofactor dependence
  • acceptor molecules such as the polyketide rapamycin [31] or DNA [143]. The use of RiPP MTs with SAM supply or SAM regeneration systems has the potential to greatly increase chemical diversity of RiPP natural products. The addition of alternative alkyl groups onto peptide substrates could further expand the
PDF
Album
Review
Published 18 Jul 2024

Polymer degrading marine Microbulbifer bacteria: an un(der)utilized source of chemical and biocatalytic novelty

  • Weimao Zhong and
  • Vinayak Agarwal

Beilstein J. Org. Chem. 2024, 20, 1635–1651, doi:10.3762/bjoc.20.146

Graphical Abstract
  • pseudobulbiferamides in Microbulbifer and pseudovibriamides in Pseudovibrio are quite similar and are located on plasmids, rather than chromosomal DNA. With the observation that Pseudovibrio and Microbulbifer co-inhabit commensal microbiomes of marine animals, it is tantalizing to speculate that this plasmid borne BGC
PDF
Album
Review
Published 17 Jul 2024

Cofactor-independent C–C bond cleavage reactions catalyzed by the AlpJ family of oxygenases in atypical angucycline biosynthesis

  • Jinmin Gao,
  • Liyuan Li,
  • Shijie Shen,
  • Guomin Ai,
  • Bin Wang,
  • Fang Guo,
  • Tongjian Yang,
  • Hui Han,
  • Zhengren Xu,
  • Guohui Pan and
  • Keqiang Fan

Beilstein J. Org. Chem. 2024, 20, 1198–1206, doi:10.3762/bjoc.20.102

Graphical Abstract
  • biosynthesis of fluostatins involves analogous B-ring cleavage and contraction steps as observed in kinamycin biosynthesis [2][13][19][26]. A sequence analysis of a reported fluostatin biosynthetic gene cluster in reassembled environmental DNA identified Flu17 as the putative ring opening oxygenase [8]. The N
  • , have been identified as cofactor-independent oxygenases [24][29][37][40][41]. Our discoveries broaden the landscape of cofactor-independent oxygenases. Experimental Materials, culture conditions, and DNA manipulations The substrates 8 and 1 were purified from the reaction mixture of AlpG and the
  • cultures of S. ambofaciens ΔΔalpJW, respectively, as previously described [11][25]. E. coli strains were grown in lysogeny broth (LB) [42]. Restriction enzymes, T4 DNA ligase, and KOD DNA polymerase were purchased from New England BioLabs. FAD and NADPH were purchased from Sigma-Aldrich. DNA manipulation
PDF
Album
Supp Info
Full Research Paper
Published 23 May 2024

Synthesis of 1,4-azaphosphinine nucleosides and evaluation as inhibitors of human cytidine deaminase and APOBEC3A

  • Maksim V. Kvach,
  • Stefan Harjes,
  • Harikrishnan M. Kurup,
  • Geoffrey B. Jameson,
  • Elena Harjes and
  • Vyacheslav V. Filichev

Beilstein J. Org. Chem. 2024, 20, 1088–1098, doi:10.3762/bjoc.20.96

Graphical Abstract
  • conditions, the charge-neutral phosphinamide was unstable, which prevented the incorporation into DNA using conventional DNA chemistry. In contrast, the negatively charged phosphinic acid derivative was incorporated into DNA instead of the target 2'-deoxycytidine using an automated DNA synthesiser, but no
  • activation-induced deaminase (AID) and APOBEC3 (A3), act preferentially on single-stranded DNA (ssDNA) containing one or multiple cytosine residues. Although some action was detected on RNA, none was observed on cytidine or cytosine alone. Each cytosine or cytidine deaminase has an important biological
  • partially localised in the nucleus of cells and, in cancer cells, become genotoxic [24]. A3A and A3H are single-domain enzymes, whereas A3B is a double-domain enzyme, in which only the C-terminal domain (CTD) has catalytic activity, and the N-terminal domain (NTD) is responsible for binding of DNA and for
PDF
Album
Supp Info
Full Research Paper
Published 15 May 2024

A Diels–Alder probe for discovery of natural products containing furan moieties

  • Alyssa S. Eggly,
  • Namuunzul Otgontseren,
  • Carson B. Roberts,
  • Amir Y. Alwali,
  • Haylie E. Hennigan and
  • Elizabeth I. Parkinson

Beilstein J. Org. Chem. 2024, 20, 1001–1010, doi:10.3762/bjoc.20.88

Graphical Abstract
  • methylenomycin A. Specifically, an MMF binds to the TetR family transcriptional repressor (TFTR) resulting in the complex being released from the DNA ultimately allowing for gene transcription and production of enzymatic machinery necessary for the biosynthesis of methylenomycin A [6][7]. To date, there have
PDF
Album
Supp Info
Full Research Paper
Published 02 May 2024

Synthesis and properties of 6-alkynyl-5-aryluracils

  • Ruben Manuel Figueira de Abreu,
  • Till Brockmann,
  • Alexander Villinger,
  • Peter Ehlers and
  • Peter Langer

Beilstein J. Org. Chem. 2024, 20, 898–911, doi:10.3762/bjoc.20.80

Graphical Abstract
  • therefore plays a very important role in many vital biological processes in the human body and other life forms. Uracil is rarely found in DNA, due to its lower stability and mutagenic properties when mismatched with guanine [2][3][4][5]. This fact can be used to differentiate between RNA and DNA-dependent
PDF
Album
Supp Info
Full Research Paper
Published 22 Apr 2024

Synthesis and characterization of water-soluble C60–peptide conjugates

  • Yue Ma,
  • Lorenzo Persi and
  • Yoko Yamakoshi

Beilstein J. Org. Chem. 2024, 20, 777–786, doi:10.3762/bjoc.20.71

Graphical Abstract
  • and nonionic polymer, poly(vinylpyrrolidone) (PVP) [25] and applied these to several in vitro biological assays to report DNA photocleavage [26] and related ROS generation [27][28], antimicrobial photoactivity [29], chondrogenesis-promoting activity [30][31], photocytotoxicity [32][33], and GST enzyme
PDF
Album
Supp Info
Full Research Paper
Published 12 Apr 2024

Methodology for awakening the potential secondary metabolic capacity in actinomycetes

  • Shun Saito and
  • Midori A. Arai

Beilstein J. Org. Chem. 2024, 20, 753–766, doi:10.3762/bjoc.20.69

Graphical Abstract
  • et al. applied a fluorescence-based DNA cleavage assay coupled with HiTES to Streptomyces clavuligerus and identified the steroid 11α-hydroxyprogesterone (14) as an effective elicitor and characterized 10 cryptic enediyne-derived natural products, designated clavulynes A (15) and B–J with unusual
PDF
Album
Review
Published 10 Apr 2024

Genome mining of labdane-related diterpenoids: Discovery of the two-enzyme pathway leading to (−)-sandaracopimaradiene in the fungus Arthrinium sacchari

  • Fumito Sato,
  • Terutaka Sonohara,
  • Shunta Fujiki,
  • Akihiro Sugawara,
  • Yohei Morishita,
  • Taro Ozaki and
  • Teigo Asai

Beilstein J. Org. Chem. 2024, 20, 714–720, doi:10.3762/bjoc.20.65

Graphical Abstract
  • fungal natural products and biosynthetic machineries have been conducted, leading to the discovery of various new natural products and enzymes [19][20][21][22][23][24][25][26][27]. Although fungal LRDs are a biologically and pharmaceutically important class of natural products including DNA polymerase α
PDF
Album
Supp Info
Full Research Paper
Published 03 Apr 2024

New variochelins from soil-isolated Variovorax sp. H002

  • Jabal Rahmat Haedar,
  • Aya Yoshimura and
  • Toshiyuki Wakimoto

Beilstein J. Org. Chem. 2024, 20, 692–700, doi:10.3762/bjoc.20.63

Graphical Abstract
  • % EtOH, dried, and dissolved in TE buffer. The extracted genomic DNA was quantified by a Qubit v3.0 fluorometer (Life Technologies, Thermo Fisher Scientific, Inc.). The Variovorax sp. H002 genome was sequenced by a DNBSEQ for short-lead sequencing and an Oxford nanopore GridION X5 for long-lead
  • sequencing. For the short-lead sequencing, the library was prepared using 100 ng of the gDNA with an MGIEasy FS DNA Library Prep Set (MGI), following the manufacturer’s protocol. The gDNA was fragmented enzymatically to approximately 400 bp. As a result of sequencing (150 bp × 2) and quality filtering (Q
  • library preparation with a Ligation Sequencing Kit (SQK-LSK 109), following the 1D genomic DNA by ligation protocol. The library was applied to a MinION flowcell (FLO MIN106 R9.41revD) operated by the MinKNOW (20.06.9) software, and then processed by Guppy basecaller (4.0.11) in the high accuracy mode. As
PDF
Album
Supp Info
Full Research Paper
Published 02 Apr 2024

Chemical and biosynthetic potential of Penicillium shentong XL-F41

  • Ran Zou,
  • Xin Li,
  • Xiaochen Chen,
  • Yue-Wei Guo and
  • Baofu Xu

Beilstein J. Org. Chem. 2024, 20, 597–606, doi:10.3762/bjoc.20.52

Graphical Abstract
  • activate the BGCs of this strain, we employed a combination of elicitors in our fermentation media, including histone deacetylase inhibitors and DNA methyltransferase inhibitors. We developed two specialized media, XISR I and XISR III, which outperformed the traditional potato dextrose broth (PDB) in
PDF
Album
Supp Info
Full Research Paper
Published 15 Mar 2024

A myo-inositol dehydrogenase involved in aminocyclitol biosynthesis of hygromycin A

  • Michael O. Akintubosun and
  • Melanie A. Higgins

Beilstein J. Org. Chem. 2024, 20, 589–596, doi:10.3762/bjoc.20.51

Graphical Abstract
  • restriction sites and verified by DNA sequencing (Eurofins Genomics). pTip-QC1-hyg17 plasmid [10] was transformed into Rhodococcus jostii RHA1 [11]. Cultures were grown in Luria Bertani (LB) media supplemented with 34 µg mL−1 chloramphenicol at 30 °C while shaking at 200 rpm for 48 h reaching an OD600 of ≈1.4
PDF
Album
Supp Info
Full Research Paper
Published 14 Mar 2024

A new analog of dihydroxybenzoic acid from Saccharopolyspora sp. KR21-0001

  • Rattiya Janthanom,
  • Yuta Kikuchi,
  • Hiroki Kanto,
  • Tomoyasu Hirose,
  • Arisu Tahara,
  • Takahiro Ishii,
  • Arinthip Thamchaipenet and
  • Yuki Inahashi

Beilstein J. Org. Chem. 2024, 20, 497–503, doi:10.3762/bjoc.20.44

Graphical Abstract
  • Island, Ou, Kumejima, Shimajiri District, Okinawa, Japan. Genomic DNA was prepared, and the 16S rRNA gene was amplified by PCR using the method of Inahashi and co-workers [23]. The sequencing analysis was performed by Eurofins Genomics. Similarity of 16S rRNA gene sequence was computed by using
PDF
Album
Supp Info
Full Research Paper
Published 29 Feb 2024

Green and sustainable approaches for the Friedel–Crafts reaction between aldehydes and indoles

  • Periklis X. Kolagkis,
  • Eirini M. Galathri and
  • Christoforos G. Kokotos

Beilstein J. Org. Chem. 2024, 20, 379–426, doi:10.3762/bjoc.20.36

Graphical Abstract
  • ]. DIM has also been found to initiate the expression of tumor suppressing proteins (ATM, p21, p27kip), which control cell growth and protect cells against ionizing radiation, which can cause DNA mutations, decreasing the overall risk of breast cancer [1][5][6]. The cytotoxicity of DIM and BIMs in
  • antiviral properties. BIMs function as selective antibacterial agents against several virulent Escherichia coli (E. coli) strains, which can cause many gut and urinary tract infections. They act by damaging DNA molecules and inhibiting their replication in bacteria, while also targeting the proteins that
  • infects a great number of agricultural plants, causing great harm to production by evolving to resist most of the existing drugs. Thus, BIMs have emerged as a new natural alternative class of antiviral agents, surpassing commonly used drugs such as ribavirin that has been observed to damage the DNA
PDF
Album
Review
Published 22 Feb 2024

Elucidating the glycan-binding specificity and structure of Cucumis melo agglutinin, a new R-type lectin

  • Jon Lundstrøm,
  • Emilie Gillon,
  • Valérie Chazalet,
  • Nicole Kerekes,
  • Antonio Di Maio,
  • Ten Feizi,
  • Yan Liu,
  • Annabelle Varrot and
  • Daniel Bojar

Beilstein J. Org. Chem. 2024, 20, 306–320, doi:10.3762/bjoc.20.31

Graphical Abstract
  • . This plasmid was obtained by PCR using pET-40b(+) (Novagen, Merck, #70091) as template and the following primers: forward (gcccagatctgggtaccGAAAACCTGTATTTTCAGGGCGccatggcgatatcgg) and reverse (GGTACCCAGATCTGGGCTGTCCATGTGCTGGC) with complementary sequence underlined. PCR was performed using PrimeSTAR DNA
  • supplier instructions (New England Biolabs, #T1020S) and ligation using the DNA ligation kit, Mighty Mix (Ozyme, Takara, #TAK6023Z), at room temperature to form the pET40b-TEV-CMA11 plasmid. The N-terminal domain of CMA1 (6–132 in mature protein) was amplified by PCR using the following primers: forward
  • (ACACCTCGAGTTAGGGTTTGTACTGTGTCACGAACATCC). The primers contained the restriction sites (underlined) NcoI (sense) and XhoI (antisense) on their 5′-ends for further sub-cloning. PCR was performed using PrimeSTAR DNA polymerase. The purified PCR fragment of 395 bp was digested by NcoI and XhoI restriction enzymes, then ligated into pET40b
PDF
Album
Supp Info
Full Research Paper
Published 19 Feb 2024

Photoinduced in situ generation of DNA-targeting ligands: DNA-binding and DNA-photodamaging properties of benzo[c]quinolizinium ions

  • Julika Schlosser,
  • Olga Fedorova,
  • Yuri Fedorov and
  • Heiko Ihmels

Beilstein J. Org. Chem. 2024, 20, 101–117, doi:10.3762/bjoc.20.11

Graphical Abstract
  • organic solvents (78–20% in MeCN). The quinolizinium derivatives bind to DNA by intercalation with binding constants of 6–11 × 104 M−1, as shown by photometric and fluorimetric titrations as well as by CD- and LD-spectroscopic analyses. These ligand–DNA complexes can also be established in situ upon
  • irradiation of the styrylpyridines and formation of the intercalator directly in the presence of DNA. In addition to the DNA-binding properties, the tested benzo[c]quinolizinium derivatives also operate as photosensitizers, which induce DNA damage at relative low concentrations and short irradiation times
  • , even under anaerobic conditions. Investigations of the mechanism of the DNA damage revealed the involvement of intermediate hydroxyl radicals and C-centered radicals. Under aerobic conditions, singlet oxygen only contributes to marginal extent to the DNA damage. Keywords: DNA intercalators
PDF
Album
Supp Info
Full Research Paper
Published 18 Jan 2024

Identification of the p-coumaric acid biosynthetic gene cluster in Kutzneria albida: insights into the diazotization-dependent deamination pathway

  • Seiji Kawai,
  • Akito Yamada,
  • Yohei Katsuyama and
  • Yasuo Ohnishi

Beilstein J. Org. Chem. 2024, 20, 1–11, doi:10.3762/bjoc.20.1

Graphical Abstract
  • vigorously used to search for novel compounds in recent years due to the rapid improvement of DNA sequence technologies and computational approaches to analyze BGCs [1][3]. Our research group previously identified the secondary metabolite-specific nitrous acid biosynthetic pathway, named ANS (aspartate
  • protein–protein interaction between the carrier protein and AMP-dependent ligase and (ii) the chain length control of highly reducing type II PKSs. Experimental Strains, chemicals, and enzymes E. coli JM109 was used for DNA manipulation, and E. coli BL21(DE3) was used for expressing recombinant proteins
  • . E. coli S17-1 was used for conjugation. Streptomyces albus J1074 was used for heterologous expression. Kutzneria albida JCM 3240 was purchased from the Japan Collection of Microorganisms. Enzymes used for DNA manipulation, including polymerase and restriction enzymes, were purchased from TaKaRa Bio
PDF
Album
Supp Info
Full Research Paper
Published 02 Jan 2024

Long oligodeoxynucleotides: chemical synthesis, isolation via catching-by-polymerization, verification via sequencing, and gene expression demonstration

  • Yipeng Yin,
  • Reed Arneson,
  • Alexander Apostle,
  • Adikari M. D. N. Eriyagama,
  • Komal Chillar,
  • Emma Burke,
  • Martina Jahfetson,
  • Yinan Yuan and
  • Shiyue Fang

Beilstein J. Org. Chem. 2023, 19, 1957–1965, doi:10.3762/bjoc.19.146

Graphical Abstract
  • engineering [3][4], mRNA vaccine [5], CRISPR/Cas9 genome editing [6], and DNA digital information storage [7] are constrained by the lack of affordable and high-quality long ODNs with no or little sequence restrictions and short turnaround time. Currently, long ODNs are mostly assembled using chemically
  • ODN sequences are provided in Supporting Information File 1) GFP gene construct was divided into a 399 and 401 nt ODNs for automated synthesis (step 1, Figure 1). The syntheses were carried out in commercial 0.2 µmol 2000 Å CPG columns on an ABI 394 DNA/RNA synthesizer using phosphoramidite chemistry
  • ], direct evidence is lacking in the literature. For the CBP method to be practically useful, we believe that characterization of the ODNs via DNA sequencing is imperative. Based on this reasoning, ODNs from three colonies originated from the 399 nt GFP gene fragment were sequenced (see Supporting
PDF
Album
Supp Info
Full Research Paper
Published 21 Dec 2023
Other Beilstein-Institut Open Science Activities