Search results

Search for "templates" in Full Text gives 98 result(s) in Beilstein Journal of Organic Chemistry.

Intermediates in monensin biosynthesis: A late step in biosynthesis of the polyether ionophore monensin is crucial for the integrity of cation binding

  • Wolfgang Hüttel,
  • Jonathan B. Spencer and
  • Peter F. Leadlay

Beilstein J. Org. Chem. 2014, 10, 361–368, doi:10.3762/bjoc.10.34

Graphical Abstract
  • : CGCGAATTCTCATGTTTGACCGCTTA TCATCGATAAGCTTTCCCGCCAGCCTCGCAGAG; SCAT2rev: CACCGGAAGGAGCTGACTGGGTTGAAGGCTC TCAAGGGCGAAGTTCCTATACTTTCTA. The cosmids Cos2 (monE) and Cos11 (monD) from a cosmid library of S. cinnamonensis [16] were used as templates for PCR. All mutants were verified by sequencing on both forward and reverse
PDF
Album
Letter
Published 10 Feb 2014

Tuning the interactions between electron spins in fullerene-based triad systems

  • Maria A. Lebedeva,
  • Thomas W. Chamberlain,
  • E. Stephen Davies,
  • Bradley E. Thomas,
  • Martin Schröder and
  • Andrei N. Khlobystov

Beilstein J. Org. Chem. 2014, 10, 332–343, doi:10.3762/bjoc.10.31

Graphical Abstract
  • and 2D ordering is a critical factor in the design of molecular electronics. For example, linear molecules can be ordered readily into 1D arrays using carbon nanotubes as templates [18] and are therefore advantageous compared to non-linear or branched molecules for which 1D packing arrangements are
PDF
Album
Supp Info
Full Research Paper
Published 05 Feb 2014

Novel supramolecular affinity materials based on (−)-isosteviol as molecular templates

  • Christina Lohoelter,
  • Malte Brutschy,
  • Daniel Lubczyk and
  • Siegfried R. Waldvogel

Beilstein J. Org. Chem. 2013, 9, 2821–2833, doi:10.3762/bjoc.9.317

Graphical Abstract
  • particular as templates for tracing air-borne arenes at low concentration. The affinities of the synthesized materials towards different air-borne arenes were determined by 200 MHz quartz crystal microbalances. Keywords: affinity materials; (−)-Isosteviol; supramolecular chemistry; triphenylene ketals
  • ; triptycenes; templates; Introduction Divalent building blocks with a well-defined geometry play a significant role in the construction of highly potent supramolecular structures [1][2][3][4][5]. The rigid nature of such architectures limits the degrees of freedom and guarantees a good preorganization [1][2
  • ][6][7][8][9][10]. Particular interest was given to C3-symmetric structures, serving e.g. as templates in asymmetric catalysis or molecular recognition [11][12][13][14]. A specific but potent subclass of such C3-symmetric architectures is represented by triphenylene ketals [15]. They have found
PDF
Album
Supp Info
Full Research Paper
Published 09 Dec 2013

Topochemical control of the photodimerization of aromatic compounds by γ-cyclodextrin thioethers in aqueous solution

  • Hai Ming Wang and
  • Gerhard Wenz

Beilstein J. Org. Chem. 2013, 9, 1858–1866, doi:10.3762/bjoc.9.217

Graphical Abstract
  • transformations in homogeneous media, and various mixtures of products are obtained. Pre-organization of the reactants in the solid state [3] or by various templates in solution has been the best solution to this problem [4][5]. Cyclic host molecules large enough to accommodate two reacting molecules are the
  • smallest possible templates for the control of photoreactions. Such a host provides a well-defined nano environment, a so-called molecular reaction vessel [6], which can catalyze and direct particular transformations. Calixarenes [7], cucurbiturils [8][9], and cyclodextrins (CDs) [10][11][12][13][14][15
PDF
Album
Supp Info
Full Research Paper
Published 12 Sep 2013

A3-Coupling catalyzed by robust Au nanoparticles covalently bonded to HS-functionalized cellulose nanocrystalline films

  • Jian-Lin Huang,
  • Derek G. Gray and
  • Chao-Jun Li

Beilstein J. Org. Chem. 2013, 9, 1388–1396, doi:10.3762/bjoc.9.155

Graphical Abstract
  • for CNCs include nanocomposite formulation, polymer reinforcement, drug delivery [27], enzyme immobilization [28], biomedical applications [29] and as templates for the synthesis of nanomaterials [30]. The deposition of metal nanoparticles onto the surface of CNCs can lead to new nano-heterogeneous
PDF
Album
Supp Info
Full Research Paper
Published 10 Jul 2013

Cascade radical reaction of substrates with a carbon–carbon triple bond as a radical acceptor

  • Hideto Miyabe,
  • Ryuta Asada and
  • Yoshiji Takemoto

Beilstein J. Org. Chem. 2013, 9, 1148–1155, doi:10.3762/bjoc.9.128

Graphical Abstract
  • 2002 that hydroxamic acid derivatives are useful achiral templates in enantioselective Diels–Alder reactions [69][70]. To study the effect of hydroxamate ester as an achiral template in the intermolecular radical reaction, our experiments began with the investigation of cascade radical addition
PDF
Album
Supp Info
Full Research Paper
Published 13 Jun 2013

Multivalent display of the antimicrobial peptides BP100 and BP143

  • Imma Güell,
  • Rafael Ferre,
  • Kasper K. Sørensen,
  • Esther Badosa,
  • Iteng Ng-Choi,
  • Emilio Montesinos,
  • Eduard Bardají,
  • Lidia Feliu,
  • Knud J. Jensen and
  • Marta Planas

Beilstein J. Org. Chem. 2012, 8, 2106–2117, doi:10.3762/bjoc.8.237

Graphical Abstract
  • -1871 Frederiksberg, Denmark Laboratory of Plant Pathology, Institute of Food and Agricultural Technology-CIDSAV-CeRTA, University of Girona, Campus Montilivi, 17071 Girona, Spain 10.3762/bjoc.8.237 Abstract Carbohydrates are considered as promising templates for the display of multiple copies of
  • action of antimicrobial peptides, which are generally poorly understood. Several scaffolds, such as linear and cyclic peptides, alkyne-functionalized dendrimers, a branched lysine core, and also a polymaleic polymer, have been exploited as templates for the synthesis of multivalent antimicrobial peptides
  • [18][19][20][21][22]. Carbohydrates are promising candidates as templates for the display of functional groups due to their inherent multifunctionality, the relative rigidity of their structure, and the ease of regioselective chemical manipulation [23][24][25]. Jensen and co-workers reported the
PDF
Album
Supp Info
Full Research Paper
Published 03 Dec 2012

An efficient access to the synthesis of novel 12-phenylbenzo[6,7]oxepino[3,4-b]quinolin-13(6H)-one derivatives

  • Wentao Gao,
  • Guihai Lin,
  • Yang Li,
  • Xiyue Tao,
  • Rui Liu and
  • Lianjie Sun

Beilstein J. Org. Chem. 2012, 8, 1849–1857, doi:10.3762/bjoc.8.213

Graphical Abstract
  • tetracyclic quinoline systems on privileged templates have significant biological properties, such as antitumoral [5][6], anti-inflammatory [7], antimalarial [8], antituberculosis [9], and antiplasmodial [10] activities. Accordingly, the synthesis of new families of such quinoline systems still attracts much
PDF
Album
Supp Info
Full Research Paper
Published 30 Oct 2012

Synthesis of trifunctional cyclo-β-tripeptide templates

  • Frank Stein,
  • Tahir Mehmood,
  • Tilman Plass,
  • Javid H. Zaidi and
  • Ulf Diederichsen

Beilstein J. Org. Chem. 2012, 8, 1576–1583, doi:10.3762/bjoc.8.180

Graphical Abstract
  • The concept of template-assembled synthetic proteins (TASP) describes a central scaffold that predefines the three dimensional structure for diverse molecules linked to this platform. Cyclic β-tripeptides are interesting candidates for use as templates due to their conformationally defined structure
  • (5) and the nucleobase moieties thymine-1-yl acetic acid (6) and (N4-benzyloxycarbonyl)cytosine-1-yl acetic acid (7) were attached to the cyclo-β-peptide yielding monofunctionalized templates 14, 10 and 12 (Figure 4). The second amino group was Fmoc-deprotected with 20% piperidine in DMF. Coupling of
PDF
Album
Full Research Paper
Published 19 Sep 2012

Cyclodextrin nanosponge-sensitized enantiodifferentiating photoisomerization of cyclooctene and 1,3-cyclooctadiene

  • Wenting Liang,
  • Cheng Yang,
  • Masaki Nishijima,
  • Gaku Fukuhara,
  • Tadashi Mori,
  • Andrea Mele,
  • Franca Castiglione,
  • Fabrizio Caldera,
  • Francesco Trotta and
  • Yoshihisa Inoue

Beilstein J. Org. Chem. 2012, 8, 1305–1311, doi:10.3762/bjoc.8.149

Graphical Abstract
  • ], hydrogen-bonding templates [12], cyclodextrins [13][14][15][16][17][18][19][20][21] and serum albumins [22][23], have hitherto been employed to mediate chiral photoreactions. External factors, such as temperature [13], solvent [17], pressure [18] and irradiation wavelength [24], have also been found to
PDF
Album
Letter
Published 16 Aug 2012

The use of glycoinformatics in glycochemistry

  • Thomas Lütteke

Beilstein J. Org. Chem. 2012, 8, 915–929, doi:10.3762/bjoc.8.104

Graphical Abstract
  • templates in vaccine development [67][68][69][70], and glycomimetics that block specific enzymes or lectins can be used for therapeutic purposes [71][72][73][74][75][76][77]. The Glycan Pathway Prediction (GPP) tool of the RINGS portal [78] can be used to predict glycans that can be obtained with a given
  • peaks that are observed in a spectrum are compared to theoretically derived fragment masses that are computed from glycan structures stored in a carbohydrate database. This approach, however, is limited by the content of the database that provides the templates for in silico fragmentation, which means
PDF
Album
Review
Published 21 Jun 2012

Multistep organic synthesis of modular photosystems

  • Naomi Sakai and
  • Stefan Matile

Beilstein J. Org. Chem. 2012, 8, 897–904, doi:10.3762/bjoc.8.102

Graphical Abstract
  • central naphthalenediimide (NDI) [4][5][6][7][8][9][10][11][12][13][14][15][16][17][18][19] to act as a template for the central stack and two peripheral NDIs to act as templates for stack exchange. They are embedded into hydrogen-bonded networks, to assure self-organization, and four geminal
  • independent of the thickness of the photosystem. Control experiments revealed that in the case of initiators without extra NDI templates, the yield drops to 40% for thin photosystems and further decreases with increasing thickness to an irrelevant 25%. This significant difference demonstrates the central
PDF
Album
Review
Published 19 Jun 2012
Graphical Abstract
  • Xing Wang Fraser Hof University of Victoria, Department of Chemistry, Victoria, BC, V8W 3V6, Canada 10.3762/bjoc.8.1 Abstract 1,3,5-triethylbenzenes have been widely used as supramolecular templates to organize molecular-recognition elements. It is believed that the steric-gearing effect of the
  • 1,3,5-triethylbenzene (1Et) and 1,3,5-trimethylbenzene (1Me) templates in a single system is very rare (see below), which raises some questions: To what extent do ethyl substituents improve the binding properties of a host? To what extent do methyl substituents improve the binding properties of a host
PDF
Album
Full Research Paper
Published 02 Jan 2012

Use of mixed Li/K metal TMP amide (LiNK chemistry) for the synthesis of [2.2]metacyclophanes

  • Marco Blangetti,
  • Patricia Fleming and
  • Donal F. O'Shea

Beilstein J. Org. Chem. 2011, 7, 1249–1254, doi:10.3762/bjoc.7.145

Graphical Abstract
  • interest notably as planar chiral scaffolds for asymmetric catalysis [9][10][11][12][13]. Surprisingly, the [2.2]metacyclophanes, which also have the potential to be exploited as planar chiral templates, have received scant attention since the seminal reports of Schlögl in the early 1970s [14][15][16]. One
PDF
Album
Supp Info
Full Research Paper
Published 09 Sep 2011

Intraannular photoreactions in pseudo-geminally substituted [2.2]paracyclophanes

  • Henning Hopf,
  • Vitaly Raev and
  • Peter G. Jones

Beilstein J. Org. Chem. 2011, 7, 658–667, doi:10.3762/bjoc.7.78

Graphical Abstract
  • strategy is to transfer the topochemical control from the solid state to a homogeneous solution using suitable templates. Such reactions are easier to analyze, design, and optimize. Templated photochemistry in solution is possible if the photoreactive moieties can be brought into suitable positions for
PDF
Album
Full Research Paper
Published 24 May 2011

Supramolecular FRET photocyclodimerization of anthracenecarboxylate with naphthalene-capped γ-cyclodextrin

  • Qian Wang,
  • Cheng Yang,
  • Gaku Fukuhara,
  • Tadashi Mori,
  • Yu Liu and
  • Yoshihisa Inoue

Beilstein J. Org. Chem. 2011, 7, 290–297, doi:10.3762/bjoc.7.38

Graphical Abstract
  • ) 3 are chiral (Scheme 1). This chiral photoreaction turned out to be an ideal benchmark system for exploring and comparing the performance of various chiral hosts, such as cyclodextrins (CDs), proteins and chiral hydrogen-bonding templates. γ-CD can significantly accelerate the photocyclodimerization
PDF
Album
Supp Info
Full Research Paper
Published 07 Mar 2011

Syntheses and properties of thienyl-substituted dithienophenazines

  • Annemarie Meyer,
  • Eva Sigmund,
  • Friedhelm Luppertz,
  • Gregor Schnakenburg,
  • Immanuel Gadaczek,
  • Thomas Bredow,
  • Stefan-S. Jester and
  • Sigurd Höger

Beilstein J. Org. Chem. 2010, 6, 1180–1187, doi:10.3762/bjoc.6.135

Graphical Abstract
  • well as cyclic and polycyclic thiophenes are valuable templates for the epitaxial coadsorption of adlayers, in particular for fullerenes and metallacycles [14][15][16][17]. Results and Discussion Here we report the syntheses of two isomeric benzodithiophenediones, their respective phenazines and their
PDF
Album
Supp Info
Full Research Paper
Published 13 Dec 2010

Miniemulsion polymerization as a versatile tool for the synthesis of functionalized polymers

  • Daniel Crespy and
  • Katharina Landfester

Beilstein J. Org. Chem. 2010, 6, 1132–1148, doi:10.3762/bjoc.6.130

Graphical Abstract
  • for photolithographic applications [36], magnetite [37], and as templates for the mineralization on the surface of particles [38]. Ethirajan et al. showed, for instance, that it was possible to use the surface of nanoparticles with carboxylate groups and calcium counterions to mineralize
PDF
Album
Video
Full Research Paper
Published 01 Dec 2010

Organic gelators and hydrogelators

  • Jean-Pierre Desvergne

Beilstein J. Org. Chem. 2010, 6, 846–847, doi:10.3762/bjoc.6.99

Graphical Abstract
  • nanoobject conception. Thus, owing to their non-conventional behaviour, low molecular weight gelators are very attractive for applications in various areas, including supramolecular templates or matrices, transport and release of drugs, art conservation, cosmetics, sensors, optoelectronics, actuators, etc
PDF
Editorial
Published 21 Sep 2010

Concise methods for the synthesis of chiral polyoxazolines and their application in asymmetric hydrosilylation

  • Wei Jie Li,
  • Zun Le Xu and
  • Sheng Xiang Qiu

Beilstein J. Org. Chem. 2010, 6, No. 29, doi:10.3762/bjoc.6.29

Graphical Abstract
  • prepare enantiomerically pure compounds; in particular, a range of mono- and bisoxazolines have been widely used as effective templates for metal-catalyzed asymmetric reactions over the last 30 years [1][2][3][4][5][6][7][8][9][10][11][12][13]. Previously, polyoxazoline ligands were reported to have good
  • –7) are described, which are much simpler and more efficient in comparison to those reported in the literature. With these chiral ligands as templates, the rhodium-catalyzed asymmetric hydrosilylation of aromatic ketones was carried out. The effects of the linkers of oxazoline rings and the
PDF
Album
Supp Info
Full Research Paper
Published 25 Mar 2010

Templated versus non-templated synthesis of benzo-21-crown-7 and the influence of substituents on its complexing properties

  • Wei Jiang and
  • Christoph A. Schalley

Beilstein J. Org. Chem. 2010, 6, No. 14, doi:10.3762/bjoc.6.14

Graphical Abstract
  • structures [1][2][3][4] are attractive to chemists not only because they are aesthetically appealing but also due to their potential applications in molecular machines and smart materials [5][6][7][8][9]. Although a few covalent templates are known [10][11][12], their synthesis most often makes use of non
  • -covalent templates [13][14][15][16], for which quite a number of different binding motifs are available that make the synthesis of many diverse and complex interlocked structures possible. Among these, the threaded interaction of secondary ammonium ions with larger crown ethers is a prominent example [17
PDF
Album
Supp Info
Full Research Paper
Published 11 Feb 2010

Synthesis of rigidified flavin–guanidinium ion conjugates and investigation of their photocatalytic properties

  • Harald Schmaderer,
  • Mouchumi Bhuyan and
  • Burkhard König

Beilstein J. Org. Chem. 2009, 5, No. 26, doi:10.3762/bjoc.5.26

Graphical Abstract
  • ] derivatives have been used as sterically defined templates enhancing the efficiency and selectivity of photoreactions [32][33][34][35][36][37][38][39][40][41][42][43]. Flavins with geometrically defined substrate binding sites have not been reported so far and we expected that the close vicinity of substrate
PDF
Album
Supp Info
Full Research Paper
Published 28 May 2009

Stereoselective α-fluoroamide and α-fluoro- γ-lactone synthesis by an asymmetric zwitterionic aza-Claisen rearrangement

  • Kenny Tenza,
  • Julian S. Northen,
  • David O'Hagan and
  • Alexandra M. Z. Slawin

Beilstein J. Org. Chem. 2005, 1, No. 13, doi:10.1186/1860-5397-1-13

Graphical Abstract
  • amines, to offer an alternative strategy to α-fluorocarbonyl compounds. Such products can be converted to γ-lactones by straightforward iodolactonisation.[14] γ-Lactones are a ubiquitious motif found in many natural product sand they are also useful templates for the synthesis of a wide range of bio
PDF
Album
Full Research Paper
Published 17 Oct 2005
Other Beilstein-Institut Open Science Activities