Synthesis and properties of 6-alkynyl-5-aryluracils

• Ruben Manuel Figueira de Abreu,
• Till Brockmann,
• Alexander Villinger,
• Peter Ehlers and
• Peter Langer

Beilstein J. Org. Chem. 2024, 20, 898–911, doi:10.3762/bjoc.20.80

• therefore plays a very important role in many vital biological processes in the human body and other life forms. Uracil is rarely found in DNA, due to its lower stability and mutagenic properties when mismatched with guanine [2][3][4][5]. This fact can be used to differentiate between RNA and DNA-dependent

Synthesis and characterization of water-soluble C₆₀–peptide conjugates

• Yue Ma,
• Lorenzo Persi and
• Yoko Yamakoshi

Beilstein J. Org. Chem. 2024, 20, 777–786, doi:10.3762/bjoc.20.71

• and nonionic polymer, poly(vinylpyrrolidone) (PVP) [25] and applied these to several in vitro biological assays to report DNA photocleavage [26] and related ROS generation [27][28], antimicrobial photoactivity [29], chondrogenesis-promoting activity [30][31], photocytotoxicity [32][33], and GST enzyme

Methodology for awakening the potential secondary metabolic capacity in actinomycetes

• Shun Saito and
• Midori A. Arai

Beilstein J. Org. Chem. 2024, 20, 753–766, doi:10.3762/bjoc.20.69

• et al. applied a fluorescence-based DNA cleavage assay coupled with HiTES to Streptomyces clavuligerus and identified the steroid 11α-hydroxyprogesterone (14) as an effective elicitor and characterized 10 cryptic enediyne-derived natural products, designated clavulynes A (15) and B–J with unusual

Genome mining of labdane-related diterpenoids: Discovery of the two-enzyme pathway leading to (−)-sandaracopimaradiene in the fungus Arthrinium sacchari

• Fumito Sato,
• Terutaka Sonohara,
• Shunta Fujiki,
• Akihiro Sugawara,
• Yohei Morishita,
• Taro Ozaki and
• Teigo Asai

Beilstein J. Org. Chem. 2024, 20, 714–720, doi:10.3762/bjoc.20.65

• fungal natural products and biosynthetic machineries have been conducted, leading to the discovery of various new natural products and enzymes [19][20][21][22][23][24][25][26][27]. Although fungal LRDs are a biologically and pharmaceutically important class of natural products including DNA polymerase α

New variochelins from soil-isolated Variovorax sp. H002

• Jabal Rahmat Haedar,
• Aya Yoshimura and
• Toshiyuki Wakimoto

Beilstein J. Org. Chem. 2024, 20, 692–700, doi:10.3762/bjoc.20.63

• % EtOH, dried, and dissolved in TE buffer. The extracted genomic DNA was quantified by a Qubit v3.0 fluorometer (Life Technologies, Thermo Fisher Scientific, Inc.). The Variovorax sp. H002 genome was sequenced by a DNBSEQ for short-lead sequencing and an Oxford nanopore GridION X5 for long-lead

• sequencing. For the short-lead sequencing, the library was prepared using 100 ng of the gDNA with an MGIEasy FS DNA Library Prep Set (MGI), following the manufacturer’s protocol. The gDNA was fragmented enzymatically to approximately 400 bp. As a result of sequencing (150 bp × 2) and quality filtering (Q

• library preparation with a Ligation Sequencing Kit (SQK-LSK 109), following the 1D genomic DNA by ligation protocol. The library was applied to a MinION flowcell (FLO MIN106 R9.41revD) operated by the MinKNOW (20.06.9) software, and then processed by Guppy basecaller (4.0.11) in the high accuracy mode. As

Chemical and biosynthetic potential of Penicillium shentong XL-F41

• Ran Zou,
• Xin Li,
• Xiaochen Chen,
• Yue-Wei Guo and
• Baofu Xu

Beilstein J. Org. Chem. 2024, 20, 597–606, doi:10.3762/bjoc.20.52

• activate the BGCs of this strain, we employed a combination of elicitors in our fermentation media, including histone deacetylase inhibitors and DNA methyltransferase inhibitors. We developed two specialized media, XISR I and XISR III, which outperformed the traditional potato dextrose broth (PDB) in

A myo-inositol dehydrogenase involved in aminocyclitol biosynthesis of hygromycin A

• Michael O. Akintubosun and
• Melanie A. Higgins

Beilstein J. Org. Chem. 2024, 20, 589–596, doi:10.3762/bjoc.20.51

• restriction sites and verified by DNA sequencing (Eurofins Genomics). pTip-QC1-hyg17 plasmid [10] was transformed into Rhodococcus jostii RHA1 [11]. Cultures were grown in Luria Bertani (LB) media supplemented with 34 µg mL−1 chloramphenicol at 30 °C while shaking at 200 rpm for 48 h reaching an OD600 of ≈1.4

A new analog of dihydroxybenzoic acid from Saccharopolyspora sp. KR21-0001

• Rattiya Janthanom,
• Yuta Kikuchi,
• Hiroki Kanto,
• Tomoyasu Hirose,
• Arisu Tahara,
• Takahiro Ishii,
• Arinthip Thamchaipenet and
• Yuki Inahashi

Beilstein J. Org. Chem. 2024, 20, 497–503, doi:10.3762/bjoc.20.44

• Island, Ou, Kumejima, Shimajiri District, Okinawa, Japan. Genomic DNA was prepared, and the 16S rRNA gene was amplified by PCR using the method of Inahashi and co-workers [23]. The sequencing analysis was performed by Eurofins Genomics. Similarity of 16S rRNA gene sequence was computed by using

Green and sustainable approaches for the Friedel–Crafts reaction between aldehydes and indoles

• Periklis X. Kolagkis,
• Eirini M. Galathri and
• Christoforos G. Kokotos

Beilstein J. Org. Chem. 2024, 20, 379–426, doi:10.3762/bjoc.20.36

• ]. DIM has also been found to initiate the expression of tumor suppressing proteins (ATM, p21, p27kip), which control cell growth and protect cells against ionizing radiation, which can cause DNA mutations, decreasing the overall risk of breast cancer [1][5][6]. The cytotoxicity of DIM and BIMs in

• antiviral properties. BIMs function as selective antibacterial agents against several virulent Escherichia coli (E. coli) strains, which can cause many gut and urinary tract infections. They act by damaging DNA molecules and inhibiting their replication in bacteria, while also targeting the proteins that

• infects a great number of agricultural plants, causing great harm to production by evolving to resist most of the existing drugs. Thus, BIMs have emerged as a new natural alternative class of antiviral agents, surpassing commonly used drugs such as ribavirin that has been observed to damage the DNA

Elucidating the glycan-binding specificity and structure of Cucumis melo agglutinin, a new R-type lectin

• Jon Lundstrøm,
• Emilie Gillon,
• Valérie Chazalet,
• Nicole Kerekes,
• Antonio Di Maio,
• Ten Feizi,
• Yan Liu,
• Annabelle Varrot and
• Daniel Bojar

Beilstein J. Org. Chem. 2024, 20, 306–320, doi:10.3762/bjoc.20.31

• . This plasmid was obtained by PCR using pET-40b(+) (Novagen, Merck, #70091) as template and the following primers: forward (gcccagatctgggtaccGAAAACCTGTATTTTCAGGGCGccatggcgatatcgg) and reverse (GGTACCCAGATCTGGGCTGTCCATGTGCTGGC) with complementary sequence underlined. PCR was performed using PrimeSTAR DNA

• supplier instructions (New England Biolabs, #T1020S) and ligation using the DNA ligation kit, Mighty Mix (Ozyme, Takara, #TAK6023Z), at room temperature to form the pET40b-TEV-CMA11 plasmid. The N-terminal domain of CMA1 (6–132 in mature protein) was amplified by PCR using the following primers: forward

• (ACACCTCGAGTTAGGGTTTGTACTGTGTCACGAACATCC). The primers contained the restriction sites (underlined) NcoI (sense) and XhoI (antisense) on their 5′-ends for further sub-cloning. PCR was performed using PrimeSTAR DNA polymerase. The purified PCR fragment of 395 bp was digested by NcoI and XhoI restriction enzymes, then ligated into pET40b

Photoinduced in situ generation of DNA-targeting ligands: DNA-binding and DNA-photodamaging properties of benzo[c]quinolizinium ions

• Julika Schlosser,
• Olga Fedorova,
• Yuri Fedorov and
• Heiko Ihmels

Beilstein J. Org. Chem. 2024, 20, 101–117, doi:10.3762/bjoc.20.11

• organic solvents (78–20% in MeCN). The quinolizinium derivatives bind to DNA by intercalation with binding constants of 6–11 × 104 M−1, as shown by photometric and fluorimetric titrations as well as by CD- and LD-spectroscopic analyses. These ligand–DNA complexes can also be established in situ upon

• irradiation of the styrylpyridines and formation of the intercalator directly in the presence of DNA. In addition to the DNA-binding properties, the tested benzo[c]quinolizinium derivatives also operate as photosensitizers, which induce DNA damage at relative low concentrations and short irradiation times

• , even under anaerobic conditions. Investigations of the mechanism of the DNA damage revealed the involvement of intermediate hydroxyl radicals and C-centered radicals. Under aerobic conditions, singlet oxygen only contributes to marginal extent to the DNA damage. Keywords: DNA intercalators

Identification of the p-coumaric acid biosynthetic gene cluster in Kutzneria albida: insights into the diazotization-dependent deamination pathway

• Seiji Kawai,
• Akito Yamada,
• Yohei Katsuyama and
• Yasuo Ohnishi

Beilstein J. Org. Chem. 2024, 20, 1–11, doi:10.3762/bjoc.20.1

• vigorously used to search for novel compounds in recent years due to the rapid improvement of DNA sequence technologies and computational approaches to analyze BGCs [1][3]. Our research group previously identified the secondary metabolite-specific nitrous acid biosynthetic pathway, named ANS (aspartate

• protein–protein interaction between the carrier protein and AMP-dependent ligase and (ii) the chain length control of highly reducing type II PKSs. Experimental Strains, chemicals, and enzymes E. coli JM109 was used for DNA manipulation, and E. coli BL21(DE3) was used for expressing recombinant proteins

• . E. coli S17-1 was used for conjugation. Streptomyces albus J1074 was used for heterologous expression. Kutzneria albida JCM 3240 was purchased from the Japan Collection of Microorganisms. Enzymes used for DNA manipulation, including polymerase and restriction enzymes, were purchased from TaKaRa Bio

Long oligodeoxynucleotides: chemical synthesis, isolation via catching-by-polymerization, verification via sequencing, and gene expression demonstration

• Yipeng Yin,
• Reed Arneson,
• Alexander Apostle,
• Adikari M. D. N. Eriyagama,
• Komal Chillar,
• Emma Burke,
• Martina Jahfetson,
• Yinan Yuan and
• Shiyue Fang

Beilstein J. Org. Chem. 2023, 19, 1957–1965, doi:10.3762/bjoc.19.146

• engineering [3][4], mRNA vaccine [5], CRISPR/Cas9 genome editing [6], and DNA digital information storage [7] are constrained by the lack of affordable and high-quality long ODNs with no or little sequence restrictions and short turnaround time. Currently, long ODNs are mostly assembled using chemically

• ODN sequences are provided in Supporting Information File 1) GFP gene construct was divided into a 399 and 401 nt ODNs for automated synthesis (step 1, Figure 1). The syntheses were carried out in commercial 0.2 µmol 2000 Å CPG columns on an ABI 394 DNA/RNA synthesizer using phosphoramidite chemistry

• ], direct evidence is lacking in the literature. For the CBP method to be practically useful, we believe that characterization of the ODNs via DNA sequencing is imperative. Based on this reasoning, ODNs from three colonies originated from the 399 nt GFP gene fragment were sequenced (see Supporting

GlAIcomics: a deep neural network classifier for spectroscopy-augmented mass spectrometric glycans data

• Thomas Barillot,
• Baptiste Schindler,
• Baptiste Moge,
• Elisa Fadda,
• Franck Lépine and
• Isabelle Compagnon

Beilstein J. Org. Chem. 2023, 19, 1825–1831, doi:10.3762/bjoc.19.134

• intelligence in combination with spectroscopy-augmented mass spectrometry for carbohydrates sequencing and glycomics applications. Keywords: Bayesian neural network; deep learning; glycomics; IR; spectroscopy; Introduction DNA and protein sequencing technologies that aim at determining the structure of a

• impact for the society in regard to the United Nations sustainable development goal [1]. The major roadblock to carbohydrate sequencing is intrinsically due to their unique molecular properties, among biopolymers. In contrast with proteins and DNA, which are linear polymers made of a limited number of

Synthesis and biological evaluation of Argemone mexicana-inspired antimicrobials

• Jessica Villegas,
• Bryce C. Ball,
• Katelyn M. Shouse,
• Caleb W. VanArragon,
• Ashley N. Wasserman,
• Hannah E. Bhakta,
• Allen G. Oliver,
• Danielle A. Orozco-Nunnelly and
• Jeffrey M. Pruet

Beilstein J. Org. Chem. 2023, 19, 1511–1524, doi:10.3762/bjoc.19.108

• often attributed to high binding affinity to DNA, interference with protein biosynthesis, induction of membrane leakage, and affecting GTPase activity in bacteria cell division [12][13][14][15]. Recent reports have also pointed to inhibition of the ‘filamenting temperature-sensitive mutant Z’ (FtsZ

• ) protein [16][17], as well as perturbing carbohydrate metabolism to generate reactive oxygen species that damage the DNA [18], as modes of action for berberine’s antibacterial effects. The antitumor properties of berberine have been attributed to DNA binding, and in particular regulating the activity of

• ]. Similar to berberine, results have demonstrated that the antibacterial activity of chelerythrine can be tied to DNA intercalation and disruption to cell membrane permeability [11][24]. One particular mechanism of action noted for chelerythrine’s antitumor bioactivity is through the inhibition of protein

Functional characterisation of twelve terpene synthases from actinobacteria

• Anuj K. Chhalodia,
• Houchao Xu,
• Georges B. Tabekoueng,
• Binbin Gu,
• Kizerbo A. Taizoumbe,
• Lukas Lauterbach and
• Jeroen S. Dickschat

Beilstein J. Org. Chem. 2023, 19, 1386–1398, doi:10.3762/bjoc.19.100

• ). The genes coding for all fifteen enzymes were amplified by PCR from genomic DNA, cloned and expressed in Escherichia coli. The purified recombinant proteins (Figure S1, Supporting Information File 1) were used in test incubations with geranyl pyrophosphate (GPP), farnesyl pyrophosphate (FPP

Synthesis of ether lipids: natural compounds and analogues

• Marco Antônio G. B. Gomes,
• Alicia Bauduin,
• Chloé Le Roux,
• Romain Fouinneteau,
• Wilfried Berthe,
• Mathieu Berchel,
• Hélène Couthon and
• Paul-Alain Jaffrès

Beilstein J. Org. Chem. 2023, 19, 1299–1369, doi:10.3762/bjoc.19.96

Phenanthridine–pyrene conjugates as fluorescent probes for DNA/RNA and an inactive mutant of dipeptidyl peptidase enzyme

• Josipa Matić,
• Tana Tandarić,
• Marijana Radić Stojković,
• Filip Šupljika,
• Zrinka Karačić,
• Ana Tomašić Paić,
• Lucija Horvat,
• Robert Vianello and
• Lidija-Marija Tumir

Beilstein J. Org. Chem. 2023, 19, 550–565, doi:10.3762/bjoc.19.40

• in the cell membrane. Keywords: dipeptidyl peptidase enzyme; excimer; molecular dynamics simulations; phenanthridine; polynucleotide; pyrene; Introduction The design of small molecules that can selectively bind and discriminate different biomolecular structures (polynucleotides vs proteins, DNA or

• extinction coefficient and long emission lifetime (>100 ns) [3]. Their large aromatic hydrophobic surface allows the intercalation between DNA/RNA base pairs and binding within the minor groove. Pyrenes are also prominent protein probes that can monitor protein conformational changes because of pyrene

• combine to produce an excimer, which is identifiable by a certain fluorescence band [11][12]. Some of the pyrenes and phenanthridines exhibited meaningful biological activity. Several pyrene-guanidiniocarbonylpyrrole derivatives have been found to exhibit the affinity for ds-DNA that is strongly pH

CuAAC-inspired synthesis of 1,2,3-triazole-bridged porphyrin conjugates: an overview

• Dileep Kumar Singh

Beilstein J. Org. Chem. 2023, 19, 349–379, doi:10.3762/bjoc.19.29

• the coumarin moiety in the case of zinc porphyrin analogues. In 2017, Yamana et at. [35] reported the synthesis of porphyrin-DNA conjugate 50 by a solid-phase “click reaction” between azidoporphyrin 39a and oligodeoxynucleotides 49 bearing an ethynyl group in the presence of CuSO4·5H2O and sodium

• ascorbate in DMSO (Scheme 9). According to UV–vis and circular dichroism (CD) spectrum measurements, the authors state that the formation of the dimer of porphyrin 50 can be attributed to DNA hybridization and through-space electronic interactions. In this investigation, it was found that the DNA serves as

• a useful skeleton to regulate the relative location of the porphyrin molecules in order to produce the improved photocurrent response from the DNA modified electrodes. In 2018, Coutsolelos et al. [36] established a “click chemistry” protocol to prepare meso-triazole-fused porphyrin conjugates 53 and

An efficient metal-free and catalyst-free C–S/C–O bond-formation strategy: synthesis of pyrazole-conjugated thioamides and amides

• Shubham Sharma,
• Dharmender Singh,
• Sunit Kumar,
• Vaishali,
• Rahul Jamra,
• Naveen Banyal,
• Deepika,
• Chandi C. Malakar and
• Virender Singh

Beilstein J. Org. Chem. 2023, 19, 231–244, doi:10.3762/bjoc.19.22

• [7], estrogen receptor ligands [8], A2A receptor antagonists [9], and DNA intercalating agents [10]. Importantly, pyrazole derivatives can be traced in a spectrum of well-established drug candidates of various categories with diverse therapeutic properties such as antipyretic [11], antibacterial [12

Insight into oral amphiphilic cyclodextrin nanoparticles for colorectal cancer: comprehensive mathematical model of drug release kinetic studies and antitumoral efficacy in 3D spheroid colon tumors

• Sedat Ünal,
• Gamze Varan,
• Juan M. Benito,
• Yeşim Aktaş and
• Erem Bilensoy

Beilstein J. Org. Chem. 2023, 19, 139–157, doi:10.3762/bjoc.19.14

• also had better release, physical stability, and cytotoxicity [13]. CPT is an anticancer small molecule drug that inhibits the topoisomerase I enzyme, which has a critical role in cellular DNA functions [14], and is effective in a wide spectrum of cancers such as metastatic colon cancer, breast cancer

Navigating and expanding the roadmap of natural product genome mining tools

• Friederike Biermann,
• Sebastian L. Wenski and
• Eric J. N. Helfrich

Beilstein J. Org. Chem. 2022, 18, 1656–1671, doi:10.3762/bjoc.18.178

• nucleotides at a certain position of a protein or DNA sequence, respectively) with pre-determined transition probabilities from one state to the next (e.g., the transition probability in a sequence between one base at a given position to another base at the next position). A sequence of probabilities is

Formal total synthesis of macarpine via a Au(I)-catalyzed 6-endo-dig cycloisomerization strategy

• Jiayue Fu,
• Bingbing Li,
• Zefang Zhou,
• Maosheng Cheng,
• Lu Yang and
• Yongxiang Liu

Beilstein J. Org. Chem. 2022, 18, 1589–1595, doi:10.3762/bjoc.18.169

• -inflammatory [4][5][6][7][8], insecticidal, fungicidal, etc [9]. In addition to the above-mentioned activities, macarpine was also used as a DNA probe for flow cytometry and fluorescence microscopy due to its fluorescent properties [10]. Despite some research on the activities of macarpine had been performed

Functionalization of imidazole N-oxide: a recent discovery in organic transformations

• Koustav Singha,
• Imran Habib and
• Mossaraf Hossain

Beilstein J. Org. Chem. 2022, 18, 1575–1588, doi:10.3762/bjoc.18.168

• histidine and the related local-immune hormone histamine. In the structural view of DNA and RNA, purine bases contain imidazole moieties. Also, imidazole N-oxides have various and intriguing applications in natural products synthesis, catalysis, and coordination chemistry [3]. Derivatives of imidazole

New triazole-substituted triterpene derivatives exhibiting anti-RSV activity: synthesis, biological evaluation, and molecular modeling

• Elenilson F. da Silva,
• Krist Helen Antunes Fernandes,
• Denise Diedrich,
• Jessica Gotardi,
• Marcia Silvana Freire Franco,
• Carlos Henrique Tomich de Paula da Silva,
• Ana Paula Duarte de Souza and
• Simone Cristina Baggio Gnoatto

Beilstein J. Org. Chem. 2022, 18, 1524–1531, doi:10.3762/bjoc.18.161

• synthesis of guanosine triphosphate, which leads to a GTP depletion, thus, it prevents the replication of many RNA and DNA viruses [10]. Despite this, its efficacy has been controversial, as its use can cause hemolytic anemia, which is the leading cause for treatment being discontinued in 36% of real-life