Activity assays of NnlA homologs suggest the natural product N-nitroglycine is degraded by diverse bacteria

• Kara A. Strickland,
• Brenda Martinez Rodriguez,
• Ashley A. Holland,
• Shelby Wagner,
• Michelle Luna-Alva,
• David E. Graham and
• Jonathan D. Caranto

Beilstein J. Org. Chem. 2024, 20, 830–840, doi:10.3762/bjoc.20.75

• pET-28a(+)-TEV by GenScript. For protein expression, plasmids were electroporated into E. coli BL21(DE3) cells and protein was expressed and purified by immobilized metal affinity chromatography (IMAC) as previously described for Vs NnlA [21]. The only modification was that plasmids using pET-28a

Advancements in hydrochlorination of alkenes

• Daniel S. Müller

Beilstein J. Org. Chem. 2024, 20, 787–814, doi:10.3762/bjoc.20.72

• state thereof, denoted with an asterisk, possessing a reduction potential of 2.0 V versus SCE (saturated calomel electrode). Subsequently, this excited state undergoes quenching through photoinduced electron transfer (PET) with styrene 5. The resulting vinyl radical cation exhibits electrophilicity at

Elucidating the glycan-binding specificity and structure of Cucumis melo agglutinin, a new R-type lectin

• Jon Lundstrøm,
• Emilie Gillon,
• Valérie Chazalet,
• Nicole Kerekes,
• Antonio Di Maio,
• Ten Feizi,
• Yan Liu,
• Annabelle Varrot and
• Daniel Bojar

Beilstein J. Org. Chem. 2024, 20, 306–320, doi:10.3762/bjoc.20.31

• . This plasmid was obtained by PCR using pET-40b(+) (Novagen, Merck, #70091) as template and the following primers: forward (gcccagatctgggtaccGAAAACCTGTATTTTCAGGGCGccatggcgatatcgg) and reverse (GGTACCCAGATCTGGGCTGTCCATGTGCTGGC) with complementary sequence underlined. PCR was performed using PrimeSTAR DNA

Photoinduced in situ generation of DNA-targeting ligands: DNA-binding and DNA-photodamaging properties of benzo[c]quinolizinium ions

• Julika Schlosser,
• Olga Fedorova,
• Yuri Fedorov and
• Heiko Ihmels

Beilstein J. Org. Chem. 2024, 20, 101–117, doi:10.3762/bjoc.20.11

• intermediates (Scheme 4). Under anaerobic conditions, the DNA damage is similar to the one observed with the isomeric benzo[c]quinolizinium ions [35]. In the latter case, it has been shown that frank DNA-strand breaks are induced by hydroxyl radicals, supposedly formed by photoinduced electron transfer (PET

Radical chemistry in polymer science: an overview and recent advances

• Zixiao Wang,
• Feichen Cui,
• Yang Sui and
• Jiajun Yan

Beilstein J. Org. Chem. 2023, 19, 1580–1603, doi:10.3762/bjoc.19.116

• . Therefore, RAFT is often used to perform chain expansion reactions or to synthesize functionalized multi-block copolymers [62][63][64]. Boyer and co-workers developed a photocatalytically mediated RAFT polymerization, PET-RAFT, which removes the requirement for conventional radical initiators. The reaction

• well-defined polymer brushes from polymer surfaces [170][171]. Photoinduced processes, including photoATRP and PET-RAFT were used [172][173][174][175]. Poly(aryl ether ketone)s such as poly(ether ether ketone), bearing a diaryl ketone moiety resembling that of benzophenone, can generate biradicals upon

Radical ligand transfer: a general strategy for radical functionalization

• David T. Nemoto Jr,
• Kang-Jie Bian,
• Shih-Chieh Kao and
• Julian G. West

Beilstein J. Org. Chem. 2023, 19, 1225–1233, doi:10.3762/bjoc.19.90

• important medical radioisotope used for positron emission tomography (PET) [43]. Optimized conditions of both isotopes included fast reaction times of under two hours; in the case of the 18F radioisotope, reactions were carried out in 10 minutes and resulted in moderate to high yields, demonstrating the

Photoredox catalysis harvesting multiple photon or electrochemical energies

• Mattia Lepori,
• Simon Schmid and
• Joshua P. Barham

Beilstein J. Org. Chem. 2023, 19, 1055–1145, doi:10.3762/bjoc.19.81

• photoexcited catalyst must be able to engage substrates/intermediates in PET to achieve a redox neutral process. In the latter, following the first photoinduced electron transfer (PET) step a subsequent electrochemical SET occurs in the same redox direction and this subsequent SET is user-tunable by the

• ., through protonation and successive reduction or HAT) that upon excitation also acts as a super-reductant (Figure 8C). Simultaneously, Jacobi von Wangelin, Pérez-Ruiz and co-workers introduced the structurally related 9,10-dicyanoanthracene (DCA) as a conPET catalyst. Excitation of PET-generated radical

• electrogeneration favor a preassembly with Ar−X that i) upon photoexcitation accesses excited states higher than the first (D1) to bolster reactivity and/or ii) following PET assists in the Ar−X•− fragmentation step. The scope was expanded using triethylphosphite (P(OEt)3), dimethyl disulfide (MeSSMe) and bis

Combining the best of both worlds: radical-based divergent total synthesis

• Kyriaki Gennaiou,
• Antonios Kelesidis,
• Maria Kourgiantaki and
• Alexandros L. Zografos

Beilstein J. Org. Chem. 2023, 19, 1–26, doi:10.3762/bjoc.19.1

• radical to circumvent the unsuccessful Friedel–Crafts reaction. Prior reports implicated β-keto radical formation in the ring opening of siloxycyclopropanes with photoinduced electron transfer (PET) to 1,4-dicyanonaphthalene [65]. Inspired by reports on dual photoredox and Ni-catalytic cross-coupling

Thermally activated delayed fluorescence (TADF) emitters: sensing and boosting spin-flipping by aggregation

• Ashish Kumar Mazumdar,
• Gyana Prakash Nanda,
• Nisha Yadav,
• Upasana Deori,
• Upasha Acharyya,
• Bahadur Sk and
• Pachaiyappan Rajamalli

Beilstein J. Org. Chem. 2022, 18, 1177–1187, doi:10.3762/bjoc.18.122

• developed mainly by focusing on photophysical processes, such as photoinduced electron transfer (PET), excited-state intramolecular proton transfer (ESIPT), fluorescence resonance energy transfer (FRET), etc. [21][22][24][25]. Several literature reports have also demonstrated the switching of fluorescence

A Streptomyces P450 enzyme dimerizes isoflavones from plants

• Run-Zhou Liu,
• Shanchong Chen and
• Lihan Zhang

Beilstein J. Org. Chem. 2022, 18, 1107–1115, doi:10.3762/bjoc.18.113

• ://www.geneious.com). Protein purification and biochemical assays The Streptomyces genome was extracted by TIANamp Bacteria DNA Kit (TIANGEN BIOTECH), and the P450 genes were amplified by PCR (Table S1, Supporting Information File 1) and cloned into a pET-28a(+) vector by the T5 exonuclease DNA assembly method [39

On the application of 3d metals for C–H activation toward bioactive compounds: The key step for the synthesis of silver bullets

• Renato L. Carvalho,
• Amanda S. de Miranda,
• Mateus P. Nunes,
• Roberto S. Gomes,
• Guilherme A. M. Jardim and
• Eufrânio N. da Silva Júnior

Beilstein J. Org. Chem. 2021, 17, 1849–1938, doi:10.3762/bjoc.17.126

Development of N-F fluorinating agents and their fluorinations: Historical perspective

• Teruo Umemoto,
• Yuhao Yang and
• Gerald B. Hammond

Beilstein J. Org. Chem. 2021, 17, 1752–1813, doi:10.3762/bjoc.17.123

• -fluorolactams 12-1, was synthesized by Sathyamurthy et al. in 1990 [55]. These compounds had already been prepared by Grakauskas and co-worker in 1970 [56], but in low yields and the N-fluorolactams were not recognized as fluorinating agents at that time. For positron emission tomography (PET), Sathyamurthy et

Sustainable manganese catalysis for late-stage C–H functionalization of bioactive structural motifs

• Jongwoo Son

Beilstein J. Org. Chem. 2021, 17, 1733–1751, doi:10.3762/bjoc.17.122

• radioisotope for positron emission tomography (PET) in clinical and preclinical research is 18F. Radiopharmaceuticals should be prepared at the late stage of the entire synthetic protocol because of the short half-lives of radioisotopes [26][27][28][29]. In their study, the authors used an aqueous 18F-fluoride

Methodologies for the synthesis of quaternary carbon centers via hydroalkylation of unactivated olefins: twenty years of advances

• Thiago S. Silva and
• Fernando Coelho

Beilstein J. Org. Chem. 2021, 17, 1565–1590, doi:10.3762/bjoc.17.112

• reaction rate-determining step in a radical mechanism in which the alkane participates in both the initiation and propagation steps of the radical chain (Scheme 37C). Photoinduced electron transfer Under photoinduced electron transfer (PET) conditions, olefins generate cation radical species that are

• reported that when a polyene 99 or 100 containing an acidic hydrogen in its structure (e.g., a free hydroxy or enol) was subjected to a PET process, the radical cascade was accompanied by a hydrogen shift to give the formal hydroalkylated product 100 or 101 containing a quaternary carbon center (Scheme 38

• reaction was observed in its absence. The authors highlighted the role of the solvent hexafluoro-2-propanol (HFIP) in the stabilization of the radical cation induced by PET and its assistance in the hydrogen shift process. Miscellaneous Lewis acid catalysis in olefin hydroalkylation reactions The ability

Synthetic accesses to biguanide compounds

• Oleksandr Grytsai,
• Cyril Ronco and
• Rachid Benhida

Beilstein J. Org. Chem. 2021, 17, 1001–1040, doi:10.3762/bjoc.17.82

Synthesis of 10-O-aryl-substituted berberine derivatives by Chan–Evans–Lam coupling and investigation of their DNA-binding properties

• Peter Jonas Wickhorst,
• Mathilda Blachnik,
• Denisa Lagumdzija and
• Heiko Ihmels

Beilstein J. Org. Chem. 2021, 17, 991–1000, doi:10.3762/bjoc.17.81

• suppressed rotation about the Ar–O bond. Nevertheless, as the emission quantum yield of the derivatives 5a–e still remained low, even at high viscosity of the medium, there obviously exist additional relaxation pathways in the excited state, most likely a photo-induced electron transfer (PET) from the 10

Valorisation of plastic waste via metal-catalysed depolymerisation

• Francesca Liguori,
• Carmen Moreno-Marrodán and
• Pierluigi Barbaro

Beilstein J. Org. Chem. 2021, 17, 589–621, doi:10.3762/bjoc.17.53

• (DEG), dipropylene glycol (DPG)) aminolysis (2-aminoethanol, 3-amino-1-propanol, ethylenediamine). Advantages of catalytic processes are obvious and can be witnessed in the hydrolysis and the glycolysis reactions of poly(ethylene terephthalate) (PET) [82][83]. Representative data are reported in

• graphical format in Figure 2 for the glycolysis reaction of PET, using titanium(IV) n-butoxide as the catalyst. Compared to the uncatalysed process, benefits include milder reaction conditions, higher selectivity and productivity and reduced generation of waste; in short, improved sustainability [84][85

• crystallinity, reduced chain mobility and hydrophobicity of polymers [114][115], which makes biodegradation often ineffective and time-consuming, particularly for polyolefins, such as polyethylene, polyvinyl chloride (PVC), polystyrene or PET [116][117]. Thus, abiotic pretreatments may be required, including UV

Formation of an exceptionally stable ketene during phototransformations of bicyclo[2.2.2]oct-5-en-2-ones having mixed chromophores

• Asitanga Ghosh

Beilstein J. Org. Chem. 2020, 16, 2297–2303, doi:10.3762/bjoc.16.190

• (characteristic of β,γ-enone moiety) and the type-B path (characteristic of an α,β-enone moiety). However, with the help of the photoinduced electron transfer (PET) reaction of 1a,c,d,g–h and photoreaction of the partially olefinated product of 1c,d,h, we have recognized that in a mixed α,β- and β,γ-enone system

Photosensitized direct C–H fluorination and trifluoromethylation in organic synthesis

• Shahboz Yakubov and
• Joshua P. Barham

Beilstein J. Org. Chem. 2020, 16, 2151–2192, doi:10.3762/bjoc.16.183

• isotopes for positron emission tomography (PET) due to their suitable half-life (t1/2 = 110 min) and low positron energy, which allows the production of high-resolution images [23]. Therefore, radiopharmaceuticals that contain fluorine substituents are in high demand. Fluorine enhances important properties

One-pot synthesis of isosorbide from cellulose or lignocellulosic biomass: a challenge?

• Isaline Bonnin,
• Raphaël Mereau,
• Thierry Tassaing and
• Karine De Oliveira Vigier

Beilstein J. Org. Chem. 2020, 16, 1713–1721, doi:10.3762/bjoc.16.143

• -isosorbide) terephthalate, can replace polyethylene terephthalate (PET) [7]. In the production of polycarbonate and epoxy resins, the physicochemical properties of isosorbide allow the replacement of bisphenol A by this bio-based molecule [8][9]. At an industrial level, isosorbide is produced from the double

Pauson–Khand reaction of fluorinated compounds

• Jorge Escorihuela,
• Daniel M. Sedgwick,
• Alberto Llobat,
• Mercedes Medio-Simón,
• Pablo Barrio and
• Santos Fustero

Beilstein J. Org. Chem. 2020, 16, 1662–1682, doi:10.3762/bjoc.16.138

• use, fluorine-containing molecules have also found key applications in the field of medical diagnosis. Two of the most powerful imaging techniques used nowadays, positron-emission tomography (PET) and magnetic resonance imaging (MRI), are routinely carried out using fluorine-containing organic

Heterogeneous photocatalysis in flow chemical reactors

• Christopher G. Thomson,
• Ai-Lan Lee and
• Filipe Vilela

Beilstein J. Org. Chem. 2020, 16, 1495–1549, doi:10.3762/bjoc.16.125

[3 + 2] Cycloaddition with photogenerated azomethine ylides in β-cyclodextrin

• Margareta Sohora,
• Leo Mandić and
• Nikola Basarić

Beilstein J. Org. Chem. 2020, 16, 1296–1304, doi:10.3762/bjoc.16.110

• complex molecules and natural products [11] since the pioneering work of Kanaoka et al. [12]. Photochemical reactions of phthalimides include H-abstractions, cycloadditions and photoinduced electron transfer (PET)[13]. We became interested in the application of photochemical H-abstraction reactions

Photocatalysis with organic dyes: facile access to reactive intermediates for synthesis

• Stephanie G. E. Amos,
• Marion Garreau,
• Luca Buzzetti and
• Jerome Waser

Beilstein J. Org. Chem. 2020, 16, 1163–1187, doi:10.3762/bjoc.16.103

• central role in the rapid expansion of photocatalytic methods [12]. These catalysts typically absorb light in the blue region and promote different activation modes, including photoinduced electron transfer (PET) and energy transfer (EnT), which respectively lead to the formation of open-shell and

• organic dye-based consecutive photoinduced electron transfer (conPET) strategy for the reduction of various aryl halides in 2014 [81]. As depicted in Scheme 13 (box 1), the conPET mechanism involves a first PET (PET1), where the excited photocatalyst (PC*) is reduced by a sacrificial electron donor D

• a second PET (PET2). With this strategy, the authors could reduce a broad variety of aryl halides 13.1 using N,N-bis(2,6-diisopropylphenyl)perylene-3,4,9,10-bis(dicarboximide), (PDI, OD20) as a conPET photocatalyst for the generation of an aryl radical (box 2). The latter could be hydrogenated or

Fluorinated phenylalanines: synthesis and pharmaceutical applications

• Laila F. Awad and
• Mohammed Salah Ayoup

Beilstein J. Org. Chem. 2020, 16, 1022–1050, doi:10.3762/bjoc.16.91

• over the last few decades. ᴅ- or ʟ-fluorinated phenylalanines have had considerable industrial and pharmaceutical applications and they have been expanded also to play an important role as potential enzyme inhibitors as well as therapeutic agents and topography imaging of tumor ecosystems using PET

• pharmaceutical applications with a focus on published synthetic methods that introduce fluorine into the phenyl, the β-carbon or the α-carbon of ᴅ-or ʟ-phenylalanines. Keywords: α-fluorophenylalanine; β- and β,β-difluorophenylalanine; fluorinated phenylalanines; PET; pharmaceuticals application; Introduction

• -difluorophenylalanine derivatives 42a,b in quantitative yields [45] (Scheme 9). The radiolabeled 2-[18F]-fluoro-ʟ-phenylalanine 46 was synthesized as a promising radiopharmaceutical agent for molecular imaging by positron emission tomography (PET). The three-step synthesis of 46 started from [18F]-fluoride exchange in