Search results

Search for "DNA" in Full Text gives 411 result(s) in Beilstein Journal of Organic Chemistry. Showing first 200.

Green and sustainable approaches for the Friedel–Crafts reaction between aldehydes and indoles

  • Periklis X. Kolagkis,
  • Eirini M. Galathri and
  • Christoforos G. Kokotos

Beilstein J. Org. Chem. 2024, 20, 379–426, doi:10.3762/bjoc.20.36

Graphical Abstract
  • ]. DIM has also been found to initiate the expression of tumor suppressing proteins (ATM, p21, p27kip), which control cell growth and protect cells against ionizing radiation, which can cause DNA mutations, decreasing the overall risk of breast cancer [1][5][6]. The cytotoxicity of DIM and BIMs in
  • antiviral properties. BIMs function as selective antibacterial agents against several virulent Escherichia coli (E. coli) strains, which can cause many gut and urinary tract infections. They act by damaging DNA molecules and inhibiting their replication in bacteria, while also targeting the proteins that
  • infects a great number of agricultural plants, causing great harm to production by evolving to resist most of the existing drugs. Thus, BIMs have emerged as a new natural alternative class of antiviral agents, surpassing commonly used drugs such as ribavirin that has been observed to damage the DNA
PDF
Album
Review
Published 22 Feb 2024

Elucidating the glycan-binding specificity and structure of Cucumis melo agglutinin, a new R-type lectin

  • Jon Lundstrøm,
  • Emilie Gillon,
  • Valérie Chazalet,
  • Nicole Kerekes,
  • Antonio Di Maio,
  • Ten Feizi,
  • Yan Liu,
  • Annabelle Varrot and
  • Daniel Bojar

Beilstein J. Org. Chem. 2024, 20, 306–320, doi:10.3762/bjoc.20.31

Graphical Abstract
  • . This plasmid was obtained by PCR using pET-40b(+) (Novagen, Merck, #70091) as template and the following primers: forward (gcccagatctgggtaccGAAAACCTGTATTTTCAGGGCGccatggcgatatcgg) and reverse (GGTACCCAGATCTGGGCTGTCCATGTGCTGGC) with complementary sequence underlined. PCR was performed using PrimeSTAR DNA
  • supplier instructions (New England Biolabs, #T1020S) and ligation using the DNA ligation kit, Mighty Mix (Ozyme, Takara, #TAK6023Z), at room temperature to form the pET40b-TEV-CMA11 plasmid. The N-terminal domain of CMA1 (6–132 in mature protein) was amplified by PCR using the following primers: forward
  • (ACACCTCGAGTTAGGGTTTGTACTGTGTCACGAACATCC). The primers contained the restriction sites (underlined) NcoI (sense) and XhoI (antisense) on their 5′-ends for further sub-cloning. PCR was performed using PrimeSTAR DNA polymerase. The purified PCR fragment of 395 bp was digested by NcoI and XhoI restriction enzymes, then ligated into pET40b
PDF
Album
Supp Info
Full Research Paper
Published 19 Feb 2024

Photoinduced in situ generation of DNA-targeting ligands: DNA-binding and DNA-photodamaging properties of benzo[c]quinolizinium ions

  • Julika Schlosser,
  • Olga Fedorova,
  • Yuri Fedorov and
  • Heiko Ihmels

Beilstein J. Org. Chem. 2024, 20, 101–117, doi:10.3762/bjoc.20.11

Graphical Abstract
  • organic solvents (78–20% in MeCN). The quinolizinium derivatives bind to DNA by intercalation with binding constants of 6–11 × 104 M−1, as shown by photometric and fluorimetric titrations as well as by CD- and LD-spectroscopic analyses. These ligand–DNA complexes can also be established in situ upon
  • irradiation of the styrylpyridines and formation of the intercalator directly in the presence of DNA. In addition to the DNA-binding properties, the tested benzo[c]quinolizinium derivatives also operate as photosensitizers, which induce DNA damage at relative low concentrations and short irradiation times
  • , even under anaerobic conditions. Investigations of the mechanism of the DNA damage revealed the involvement of intermediate hydroxyl radicals and C-centered radicals. Under aerobic conditions, singlet oxygen only contributes to marginal extent to the DNA damage. Keywords: DNA intercalators
PDF
Album
Supp Info
Full Research Paper
Published 18 Jan 2024

Identification of the p-coumaric acid biosynthetic gene cluster in Kutzneria albida: insights into the diazotization-dependent deamination pathway

  • Seiji Kawai,
  • Akito Yamada,
  • Yohei Katsuyama and
  • Yasuo Ohnishi

Beilstein J. Org. Chem. 2024, 20, 1–11, doi:10.3762/bjoc.20.1

Graphical Abstract
  • vigorously used to search for novel compounds in recent years due to the rapid improvement of DNA sequence technologies and computational approaches to analyze BGCs [1][3]. Our research group previously identified the secondary metabolite-specific nitrous acid biosynthetic pathway, named ANS (aspartate
  • protein–protein interaction between the carrier protein and AMP-dependent ligase and (ii) the chain length control of highly reducing type II PKSs. Experimental Strains, chemicals, and enzymes E. coli JM109 was used for DNA manipulation, and E. coli BL21(DE3) was used for expressing recombinant proteins
  • . E. coli S17-1 was used for conjugation. Streptomyces albus J1074 was used for heterologous expression. Kutzneria albida JCM 3240 was purchased from the Japan Collection of Microorganisms. Enzymes used for DNA manipulation, including polymerase and restriction enzymes, were purchased from TaKaRa Bio
PDF
Album
Supp Info
Full Research Paper
Published 02 Jan 2024

Long oligodeoxynucleotides: chemical synthesis, isolation via catching-by-polymerization, verification via sequencing, and gene expression demonstration

  • Yipeng Yin,
  • Reed Arneson,
  • Alexander Apostle,
  • Adikari M. D. N. Eriyagama,
  • Komal Chillar,
  • Emma Burke,
  • Martina Jahfetson,
  • Yinan Yuan and
  • Shiyue Fang

Beilstein J. Org. Chem. 2023, 19, 1957–1965, doi:10.3762/bjoc.19.146

Graphical Abstract
  • engineering [3][4], mRNA vaccine [5], CRISPR/Cas9 genome editing [6], and DNA digital information storage [7] are constrained by the lack of affordable and high-quality long ODNs with no or little sequence restrictions and short turnaround time. Currently, long ODNs are mostly assembled using chemically
  • ODN sequences are provided in Supporting Information File 1) GFP gene construct was divided into a 399 and 401 nt ODNs for automated synthesis (step 1, Figure 1). The syntheses were carried out in commercial 0.2 µmol 2000 Å CPG columns on an ABI 394 DNA/RNA synthesizer using phosphoramidite chemistry
  • ], direct evidence is lacking in the literature. For the CBP method to be practically useful, we believe that characterization of the ODNs via DNA sequencing is imperative. Based on this reasoning, ODNs from three colonies originated from the 399 nt GFP gene fragment were sequenced (see Supporting
PDF
Album
Supp Info
Full Research Paper
Published 21 Dec 2023

GlAIcomics: a deep neural network classifier for spectroscopy-augmented mass spectrometric glycans data

  • Thomas Barillot,
  • Baptiste Schindler,
  • Baptiste Moge,
  • Elisa Fadda,
  • Franck Lépine and
  • Isabelle Compagnon

Beilstein J. Org. Chem. 2023, 19, 1825–1831, doi:10.3762/bjoc.19.134

Graphical Abstract
  • intelligence in combination with spectroscopy-augmented mass spectrometry for carbohydrates sequencing and glycomics applications. Keywords: Bayesian neural network; deep learning; glycomics; IR; spectroscopy; Introduction DNA and protein sequencing technologies that aim at determining the structure of a
  • impact for the society in regard to the United Nations sustainable development goal [1]. The major roadblock to carbohydrate sequencing is intrinsically due to their unique molecular properties, among biopolymers. In contrast with proteins and DNA, which are linear polymers made of a limited number of
PDF
Album
Supp Info
Full Research Paper
Published 05 Dec 2023

Synthesis and biological evaluation of Argemone mexicana-inspired antimicrobials

  • Jessica Villegas,
  • Bryce C. Ball,
  • Katelyn M. Shouse,
  • Caleb W. VanArragon,
  • Ashley N. Wasserman,
  • Hannah E. Bhakta,
  • Allen G. Oliver,
  • Danielle A. Orozco-Nunnelly and
  • Jeffrey M. Pruet

Beilstein J. Org. Chem. 2023, 19, 1511–1524, doi:10.3762/bjoc.19.108

Graphical Abstract
  • often attributed to high binding affinity to DNA, interference with protein biosynthesis, induction of membrane leakage, and affecting GTPase activity in bacteria cell division [12][13][14][15]. Recent reports have also pointed to inhibition of the ‘filamenting temperature-sensitive mutant Z’ (FtsZ
  • ) protein [16][17], as well as perturbing carbohydrate metabolism to generate reactive oxygen species that damage the DNA [18], as modes of action for berberine’s antibacterial effects. The antitumor properties of berberine have been attributed to DNA binding, and in particular regulating the activity of
  • ]. Similar to berberine, results have demonstrated that the antibacterial activity of chelerythrine can be tied to DNA intercalation and disruption to cell membrane permeability [11][24]. One particular mechanism of action noted for chelerythrine’s antitumor bioactivity is through the inhibition of protein
PDF
Album
Supp Info
Full Research Paper
Published 29 Sep 2023

Functional characterisation of twelve terpene synthases from actinobacteria

  • Anuj K. Chhalodia,
  • Houchao Xu,
  • Georges B. Tabekoueng,
  • Binbin Gu,
  • Kizerbo A. Taizoumbe,
  • Lukas Lauterbach and
  • Jeroen S. Dickschat

Beilstein J. Org. Chem. 2023, 19, 1386–1398, doi:10.3762/bjoc.19.100

Graphical Abstract
  • ). The genes coding for all fifteen enzymes were amplified by PCR from genomic DNA, cloned and expressed in Escherichia coli. The purified recombinant proteins (Figure S1, Supporting Information File 1) were used in test incubations with geranyl pyrophosphate (GPP), farnesyl pyrophosphate (FPP
PDF
Album
Supp Info
Full Research Paper
Published 15 Sep 2023

Synthesis of ether lipids: natural compounds and analogues

  • Marco Antônio G. B. Gomes,
  • Alicia Bauduin,
  • Chloé Le Roux,
  • Romain Fouinneteau,
  • Wilfried Berthe,
  • Mathieu Berchel,
  • Hélène Couthon and
  • Paul-Alain Jaffrès

Beilstein J. Org. Chem. 2023, 19, 1299–1369, doi:10.3762/bjoc.19.96

Graphical Abstract
PDF
Album
Review
Published 08 Sep 2023

Phenanthridine–pyrene conjugates as fluorescent probes for DNA/RNA and an inactive mutant of dipeptidyl peptidase enzyme

  • Josipa Matić,
  • Tana Tandarić,
  • Marijana Radić Stojković,
  • Filip Šupljika,
  • Zrinka Karačić,
  • Ana Tomašić Paić,
  • Lucija Horvat,
  • Robert Vianello and
  • Lidija-Marija Tumir

Beilstein J. Org. Chem. 2023, 19, 550–565, doi:10.3762/bjoc.19.40

Graphical Abstract
  • in the cell membrane. Keywords: dipeptidyl peptidase enzyme; excimer; molecular dynamics simulations; phenanthridine; polynucleotide; pyrene; Introduction The design of small molecules that can selectively bind and discriminate different biomolecular structures (polynucleotides vs proteins, DNA or
  • extinction coefficient and long emission lifetime (>100 ns) [3]. Their large aromatic hydrophobic surface allows the intercalation between DNA/RNA base pairs and binding within the minor groove. Pyrenes are also prominent protein probes that can monitor protein conformational changes because of pyrene
  • combine to produce an excimer, which is identifiable by a certain fluorescence band [11][12]. Some of the pyrenes and phenanthridines exhibited meaningful biological activity. Several pyrene-guanidiniocarbonylpyrrole derivatives have been found to exhibit the affinity for ds-DNA that is strongly pH
PDF
Album
Supp Info
Full Research Paper
Published 26 Apr 2023

CuAAC-inspired synthesis of 1,2,3-triazole-bridged porphyrin conjugates: an overview

  • Dileep Kumar Singh

Beilstein J. Org. Chem. 2023, 19, 349–379, doi:10.3762/bjoc.19.29

Graphical Abstract
  • the coumarin moiety in the case of zinc porphyrin analogues. In 2017, Yamana et at. [35] reported the synthesis of porphyrin-DNA conjugate 50 by a solid-phase “click reaction” between azidoporphyrin 39a and oligodeoxynucleotides 49 bearing an ethynyl group in the presence of CuSO4·5H2O and sodium
  • ascorbate in DMSO (Scheme 9). According to UV–vis and circular dichroism (CD) spectrum measurements, the authors state that the formation of the dimer of porphyrin 50 can be attributed to DNA hybridization and through-space electronic interactions. In this investigation, it was found that the DNA serves as
  • a useful skeleton to regulate the relative location of the porphyrin molecules in order to produce the improved photocurrent response from the DNA modified electrodes. In 2018, Coutsolelos et al. [36] established a “click chemistry” protocol to prepare meso-triazole-fused porphyrin conjugates 53 and
PDF
Album
Review
Published 22 Mar 2023

An efficient metal-free and catalyst-free C–S/C–O bond-formation strategy: synthesis of pyrazole-conjugated thioamides and amides

  • Shubham Sharma,
  • Dharmender Singh,
  • Sunit Kumar,
  • Vaishali,
  • Rahul Jamra,
  • Naveen Banyal,
  • Deepika,
  • Chandi C. Malakar and
  • Virender Singh

Beilstein J. Org. Chem. 2023, 19, 231–244, doi:10.3762/bjoc.19.22

Graphical Abstract
  • [7], estrogen receptor ligands [8], A2A receptor antagonists [9], and DNA intercalating agents [10]. Importantly, pyrazole derivatives can be traced in a spectrum of well-established drug candidates of various categories with diverse therapeutic properties such as antipyretic [11], antibacterial [12
PDF
Album
Supp Info
Full Research Paper
Published 02 Mar 2023

Insight into oral amphiphilic cyclodextrin nanoparticles for colorectal cancer: comprehensive mathematical model of drug release kinetic studies and antitumoral efficacy in 3D spheroid colon tumors

  • Sedat Ünal,
  • Gamze Varan,
  • Juan M. Benito,
  • Yeşim Aktaş and
  • Erem Bilensoy

Beilstein J. Org. Chem. 2023, 19, 139–157, doi:10.3762/bjoc.19.14

Graphical Abstract
  • also had better release, physical stability, and cytotoxicity [13]. CPT is an anticancer small molecule drug that inhibits the topoisomerase I enzyme, which has a critical role in cellular DNA functions [14], and is effective in a wide spectrum of cancers such as metastatic colon cancer, breast cancer
PDF
Album
Full Research Paper
Published 13 Feb 2023

Navigating and expanding the roadmap of natural product genome mining tools

  • Friederike Biermann,
  • Sebastian L. Wenski and
  • Eric J. N. Helfrich

Beilstein J. Org. Chem. 2022, 18, 1656–1671, doi:10.3762/bjoc.18.178

Graphical Abstract
  • nucleotides at a certain position of a protein or DNA sequence, respectively) with pre-determined transition probabilities from one state to the next (e.g., the transition probability in a sequence between one base at a given position to another base at the next position). A sequence of probabilities is
PDF
Album
Perspective
Published 06 Dec 2022

Formal total synthesis of macarpine via a Au(I)-catalyzed 6-endo-dig cycloisomerization strategy

  • Jiayue Fu,
  • Bingbing Li,
  • Zefang Zhou,
  • Maosheng Cheng,
  • Lu Yang and
  • Yongxiang Liu

Beilstein J. Org. Chem. 2022, 18, 1589–1595, doi:10.3762/bjoc.18.169

Graphical Abstract
  • -inflammatory [4][5][6][7][8], insecticidal, fungicidal, etc [9]. In addition to the above-mentioned activities, macarpine was also used as a DNA probe for flow cytometry and fluorescence microscopy due to its fluorescent properties [10]. Despite some research on the activities of macarpine had been performed
PDF
Album
Supp Info
Letter
Published 23 Nov 2022

Functionalization of imidazole N-oxide: a recent discovery in organic transformations

  • Koustav Singha,
  • Imran Habib and
  • Mossaraf Hossain

Beilstein J. Org. Chem. 2022, 18, 1575–1588, doi:10.3762/bjoc.18.168

Graphical Abstract
  • histidine and the related local-immune hormone histamine. In the structural view of DNA and RNA, purine bases contain imidazole moieties. Also, imidazole N-oxides have various and intriguing applications in natural products synthesis, catalysis, and coordination chemistry [3]. Derivatives of imidazole
PDF
Album
Review
Published 22 Nov 2022

New triazole-substituted triterpene derivatives exhibiting anti-RSV activity: synthesis, biological evaluation, and molecular modeling

  • Elenilson F. da Silva,
  • Krist Helen Antunes Fernandes,
  • Denise Diedrich,
  • Jessica Gotardi,
  • Marcia Silvana Freire Franco,
  • Carlos Henrique Tomich de Paula da Silva,
  • Ana Paula Duarte de Souza and
  • Simone Cristina Baggio Gnoatto

Beilstein J. Org. Chem. 2022, 18, 1524–1531, doi:10.3762/bjoc.18.161

Graphical Abstract
  • synthesis of guanosine triphosphate, which leads to a GTP depletion, thus, it prevents the replication of many RNA and DNA viruses [10]. Despite this, its efficacy has been controversial, as its use can cause hemolytic anemia, which is the leading cause for treatment being discontinued in 36% of real-life
PDF
Album
Supp Info
Full Research Paper
Published 09 Nov 2022

On drug discovery against infectious diseases and academic medicinal chemistry contributions

  • Yves L. Janin

Beilstein J. Org. Chem. 2022, 18, 1355–1378, doi:10.3762/bjoc.18.141

Graphical Abstract
  • is providing a very large database of predicted protein structures, being one of the latest achievements in the domain [5]. – The development of organic chemistry tools enabling a faster synthesis of compounds and, more important, a faster purification/identification (i.e., DNA-tracked synthesis
  • . These turned out to also be effective against SARS-CoV-2 main protease [243] and thus provided the key structure-based data for two distinct fruitful hit to lead programs against this virus [78][81][82]. The current generation of DNA-encoded libraries, a technique which stemmed from an academic [244
  • ][245] thought experiment and was quickly adopted by industrials [246][247], is also a noteworthy incentive for innovation in organic chemistry [248][249][250][251][252]. However, and still on COVID-19, the DNA-encoded chemical library approach which led to yet another aldehyde-bearing compound
PDF
Album
Perspective
Published 29 Sep 2022

Experimental and theoretical studies on the synthesis of 1,4,5-trisubstituted pyrrolidine-2,3-diones

  • Nguyen Tran Nguyen,
  • Vo Viet Dai,
  • Nguyen Ngoc Tri,
  • Luc Van Meervelt,
  • Nguyen Tien Trung and
  • Wim Dehaen

Beilstein J. Org. Chem. 2022, 18, 1140–1153, doi:10.3762/bjoc.18.118

Graphical Abstract
  • Ministry of Education and Training, Vietnam (project grant B2021-DNA-17).
PDF
Album
Supp Info
Full Research Paper
Published 31 Aug 2022

A Streptomyces P450 enzyme dimerizes isoflavones from plants

  • Run-Zhou Liu,
  • Shanchong Chen and
  • Lihan Zhang

Beilstein J. Org. Chem. 2022, 18, 1107–1115, doi:10.3762/bjoc.18.113

Graphical Abstract
  • ://www.geneious.com). Protein purification and biochemical assays The Streptomyces genome was extracted by TIANamp Bacteria DNA Kit (TIANGEN BIOTECH), and the P450 genes were amplified by PCR (Table S1, Supporting Information File 1) and cloned into a pET-28a(+) vector by the T5 exonuclease DNA assembly method [39
PDF
Album
Supp Info
Full Research Paper
Published 26 Aug 2022

Isolation and biosynthesis of daturamycins from Streptomyces sp. KIB-H1544

  • Yin Chen,
  • Jinqiu Ren,
  • Ruimin Yang,
  • Jie Li,
  • Sheng-Xiong Huang and
  • Yijun Yan

Beilstein J. Org. Chem. 2022, 18, 1009–1016, doi:10.3762/bjoc.18.101

Graphical Abstract
  • Diego, CA) by BGI (BGI-Shenzhen, China). According to standard procedures, the genomic DNA was digested with MboI, and the 30–42 kb DNA fragments were isolated and ligated to cosmid pSuperCos I. MaxPlax Lambda packaging extracts were used for packaging. About 2,000 E. coli clones were picked and stored
  • mM MgCl2. Double crossover mutants were selected based on the Kan-Apr and then confirmed by PCR using primers. Finally, the mutant strain S. sp. KIB-H1544-∆datA was generated (Table S2, Supporting Information File 1). Expression and purification of recombinant DatA and EchA protein The DNA fragment
  • containing datA was amplified by the primer pair Duet-DatA-F/Duet-DatA-R (Table S3, Supporting Information File 1), then cleaved by BamH I and Sac I, and inserted into the corresponding site of pETDuet-sfp to produce plasmid pETDuet-sfp-datA. As a positive control, the DNA fragment containing echA gene
PDF
Album
Supp Info
Full Research Paper
Published 09 Aug 2022

Synthesis of novel alkynyl imidazopyridinyl selenides: copper-catalyzed tandem selenation of selenium with 2-arylimidazo[1,2-a]pyridines and terminal alkynes

  • Mio Matsumura,
  • Kaho Tsukada,
  • Kiwa Sugimoto,
  • Yuki Murata and
  • Shuji Yasuike

Beilstein J. Org. Chem. 2022, 18, 863–871, doi:10.3762/bjoc.18.87

Graphical Abstract
  • -alkynylselenides III exhibits a binding interaction between calf-thymus DNA and human serum albumin [13]. Moreover, imidazopyridine derivatives IV with selanyl groups, 3-aryl- or alkylselanylimidazo[1,2-a]pyridines, were reported to act as potential antioxidants and showed antiproliferative activity [14][15
PDF
Album
Supp Info
Full Research Paper
Published 19 Jul 2022

Synthesis and HDAC inhibitory activity of pyrimidine-based hydroxamic acids

  • Virginija Jakubkiene,
  • Gabrielius Ernis Valiulis,
  • Markus Schweipert,
  • Asta Zubriene,
  • Daumantas Matulis,
  • Franz-Josef Meyer-Almes and
  • Sigitas Tumkevicius

Beilstein J. Org. Chem. 2022, 18, 837–844, doi:10.3762/bjoc.18.84

Graphical Abstract
  • . This function is essential in the transcription of DNA, as histones with acetyl groups do not interact as strongly with DNA, which opens the chromatin for transcription. HDACs also interact with other cellular proteins to regulate vital functions such as cell differentiation or apoptosis. They have
PDF
Album
Supp Info
Full Research Paper
Published 13 Jul 2022

Identification of the new prenyltransferase Ubi-297 from marine bacteria and elucidation of its substrate specificity

  • Jamshid Amiri Moghaddam,
  • Huijuan Guo,
  • Karsten Willing,
  • Thomas Wichard and
  • Christine Beemelmanns

Beilstein J. Org. Chem. 2022, 18, 722–731, doi:10.3762/bjoc.18.72

Graphical Abstract
  • process of the aromatic substrate (Figure 4B and 4C). Heterologous production of UbiA-297 To enable investigations into the substrate scope of UbiA-297, the coding gene sequence ubiA-297 was amplified from the genomic DNA of Maribacter sp. MS6, while homologous sequences encoded in Z. uliginosa DSM 2061
  • pET28a(+) vectors were used, and E. coli BL21 was used as production host. Cultures were supplemented with ampicillin (100 µg mL−1) and kanamycin (60 µg mL−1) for the selection of plasmids. DNA isolation, PCR amplification, and cloning: gDNA of Maribacter sp. MS6 was extracted using DNeasy Blood & Tissue
  • Kit (Qiagen) and PCR amplification of ubiA-297 (922 bp) and menA-1335 (952 bp) genes was carried out using S7 Fusion High-Fidelity DNA Polymerase (Biozym) and designated primer sequences (ubiA-297 forward 5’-CAGGATCCAGGATGTCCAATAAACTAATG-3’ reverse 5’-CGAAGCTTGTCTTAGGTAATGGCAAAAAG-3’; menA forward 5
PDF
Album
Supp Info
Full Research Paper
Published 22 Jun 2022

Shift of the reaction equilibrium at high pressure in the continuous synthesis of neuraminic acid

  • Jannis A. Reich,
  • Miriam Aßmann,
  • Kristin Hölting,
  • Paul Bubenheim,
  • Jürgen Kuballa and
  • Andreas Liese

Beilstein J. Org. Chem. 2022, 18, 567–579, doi:10.3762/bjoc.18.59

Graphical Abstract
  • epimerase (N-acyl-ᴅ-glucosamine 2-epimerase, EC 5.1.3.8) from Pedobacter heparinus was ordered as codon optimized gBlocks gene fragment (Integrated DNA Technologies, Leuven, Belgium). The gene for the aldolase (N-acetylneuraminate lyase, EC 4.1.3.3) was amplified from the genomic DNA of Escherichia coli K12
PDF
Album
Full Research Paper
Published 20 May 2022
Other Beilstein-Institut Open Science Activities